Does oxidase, catalyzes the oxidation of molecular oxygen? True or False
Q: Acetyl CoA + 2H* + 2e = pyruvate + COASH Ubiquinone + 2H* + 2e = Ubiquinol E* = -0.48 V E" = +0.04 V…
A: If the reaction has a positive value of standard cell potential/standard reduction potential or a…
Q: How are the organelles in a cell similar to the organs in a human body? Explain in 3-5 sentences.
A: Organelles are cellular components, which perform specific functions inside the cell. Different…
Q: Which of the following enzyme catalyzes the first step of glycolysis? Group of answer choices…
A: Glycolysis : Process in which the glucose gets broken to produce pyruvate, ATP, NADH and water.
Q: Since in this patient pyruvate kinase is abnormal not only is less pyruvate made but intermediates…
A: Pyruvate kinase deficiency (PKD) is a rare genetic condition that causes hemolytic anemia, or the…
Q: Starting with a 4-carbon growing fatty acid attached to the ketoacyl synthase (KSase) site, and a…
A: Fatty acid metabolism includes Fatty acid biosynthesis (an anabolic process) and β-…
Q: Carbohydrates and lipids are composed of the same chemical element, but in different proportions.…
A: Carbohydrates and lipids are the primary energy source for metabolic process in the body.
Q: A glycogen polymer and an amylopectin polymer, each containing 100 monosaccharide subunits, are…
A: Amylopectin and glucogen are examples of branched polysaccharides.
Q: Identify if the following is a pyrimidine/purine nucleotide or a pyrimidine/purine nucleoside and…
A: The structure of pyrimidine/ purine nucleoside or pyrimidine/ purine nucleotide with ribose or…
Q: c. Ribulose 5-phosphate levels would decrease. d. NADH to NAD+ ratios would decrease. e.…
A: In the RBC's of the patients certain changes are observed. Ribulose 5 Phosphate levels would…
Q: Given below is the DNA template. What are the gene products? 3’ TACCGGCCTATCTAGGGCCATGGCTTAATTCCC 5’…
A: DNA is the sequence of Nucleotides that are transcribed into mRNA during transcription. Once DNA is…
Q: Which amino acid(s) are more commonly found at the At which position(s) are amino acids limited to…
A: Proteins are composed of amino acids, which are bound together by peptide linkage. Amino acids…
Q: Why is understanding reaction rates significant? Indicate at least 3 key importance of understanding…
A: Enzymes are biocatalyst that increases the speed of reaction by lowering the activation…
Q: calculate the net charge of your peptide at I) pH 2.0; ii) pH 6.0 iii) pH 7.0; iv) pH 11.5. show…
A: Amino acids contain ionizable groups, the ionic form of the amino acids depends on the pH. The…
Q: Which of the following is NOT true regarding nicotine? a. its psychoactive effects include…
A: Nicotine is a toxic substance present in tobacco. Nicotine is addictive and is hard to quit. It…
Q: Why are unsaturated fats considered healthier?
A: Unsaturated fatty acids consist of a double bond between molecules of the fatty acid chains, whereas…
Q: Biochemistry: Diagram the biosynthetic pathway from precursors (like amino acids, PRPP, etc.) to…
A: There are two pathways for the biosynthesis of nucleotides: de novo and the salvage pathways. In the…
Q: What is the relationship between the cooling of organs and tissues for medical transplants and the…
A: For patients with end-stage disease, organ transplantation is the most effective therapy. Donor…
Q: After intense activity, your muscles feel sore because of ______. Group of answer choices the…
A: During intense activity our body needs more energy (ATP).
Q: Phospholipids have ____ fatty acids while triglycerides _____ fatty acids.
A: Lipids are defined as organic substances insoluble in water but soluble in organic solvents like…
Q: Morphine (give structure) and enkephelin (give structure) both are antagonists of the m opioid…
A: Morphine is pain medication which is used in Treatment of pain.this is belongs to opiate family.…
Q: A buffer can protect against changes in pH when hydrogen ion or hydroxide ion is added to a reaction…
A: Buffer solution is two types, Acidic buffer - this is composed of a weak acid and it's conjugate…
Q: Draw the two amino acids serine and alanine, and a dipeptide that could be formed by combining these…
A: Amino acids are the building blocks of proteins which are composed of amino group (NH3+), carboxyl…
Q: topic: sds-page gel If APS is not available, what other chemicals can be used alternatively to…
A: APS stands for Ammonium Persulfate. It is an oxidizing agent that is used along with TEMED in order…
Q: Microbes can provide beneficial activities. Bioremediation (using bacteria) is a process used to…
A: Bioremediation is a waste management technique. Living organisms can be used in this process to…
Q: 12 If strong-base anion exchange resin is applied to treat raw water with silicate, the pH of raw…
A: Note : Hi ! Thank you for the question. We are authorized to answer one question at a time. Since…
Q: COO co0 C=0 C=0 + CH2 ČH3 COO The name of enzyme that catalyzes above reaction is Select ] and the…
A: Here, a reaction is given in the question and we have to identify the enzyme which catalyzes this…
Q: Look at tho structuros of tho blood group dotorminante. Red blood cell N-Acetyl- D-glucosamine Blood…
A: Blood group antigens are O-glycoproteins, N-glycoproteins, and glycolipids that are present on the…
Q: . Considering the following nucleotide sequence in an mRNA molecule: 5’ AUG UUA CGU AAU GCU GUC…
A: Since you have posted a question with multiple subparts, we will solve the first three subparts for…
Q: What is the difference between Raman Spectroscopy and SERS ( Surface Enhanced Raman Spectroscopy).
A: Introduction: It is the most powerful tool to study the interactions between matter and…
Q: Why does picric acid and tannic acid are used to treat burn?
A: PICRIC ACID : Picric acid is an organic compound containing IUPAC name as TNP (2,4,6 tri nitro…
Q: How many more acetyl CoA are generated from stearic acid than from linoleic acid during beta…
A: The process of beta oxidation of stearic acid yields two distinct products and these are acetyl-CoA…
Q: In a single pass through of the b-oxidation pathway, what are products that can be used in a…
A: Introduction: The fatty acids present in our diet or produced through the degradation of…
Q: List down the specific functions of the component structures of mitochondrion relative to cellular…
A: The mitochondrion is a membrane-bound organelle. It is called as powerhouse of the cell, it plays a…
Q: CH,O-P-o C=O 0. CH,O-P-o- CH-OH C=O Ó. HO-C-H H-C-OH H-C-OH O C-H of ČH;O-P-0- H-C-OH O CH;0-P-O 0.
A: Glycolysis is the metabolic pathway that converts glucose into pyruvic acid.
Q: 5- Draw structure of products in the following metabolic reactions and name the enzyr involved and…
A: Introduction: The drug metabolism is needed to convert non-polar lipophilic compounds into polar…
Q: Make an analysis of the electrophoresis data below. Comment on the purity, number of subunits, and…
A: Native gel electrophoresis is the process of separation without adding any denaturing agent like…
Q: Draw the reactions and the interpretation on the lysine iron agar (lia) test for Proteus vulgaris
A: Proteus vulgaris is a gram negative, rod shaped facultative anaerobe in the Enterobacteriaceae…
Q: 4. During a lunch at a McDonald's outlet, an office employee received about 350 g of carbohydrates…
A: for you. If you want a specific question to be answered then please specify the question number or…
Q: Which among the following statements is correct? Negatively-charged proteins are eluted out first…
A: Affinity chromatography is an analytical method for separating biomolecules in a mixture, based on…
Q: Suppose the codon sequence GCCAUUCAAGCGGAU has a single base pair mutation to GCCAUUCAAACgGAU. If…
A: DNA replication being very complex process, there are chances of miss reading the DNA template and…
Q: How does NanoDrop quantify DNA?
A: Quantitative analysis techniques are used to measure the quantity of a substance in a solution.…
Q: 7. Describe the falient features and functions of steroids.
A: Steroids are biologically active compounds. Steroids are found in plants, animals and fungi.…
Q: Mitochondria are considered to be the powerhouses of eukaryotic cells because they produce ATP,…
A: Citric acid cycle metabolizes acetyl-coA derived from glucose. Fermentation of lactic acid produces…
Q: 3. (а) 0.0050 M operate at one-quarter of its maximum rate? At what substrate concentration would an…
A: To study an enzyme kinetics, Michaelis-Menten kinetics equation is best known mathematical…
Q: response. 5. Since in this patient pyruvate kinase is abnormal not only is less pyruvate made but…
A: RBCs are little red blood cells that transport oxygen from the lungs to the whole of the body's…
Q: In a reverse phase chromatography set up, the component that yields the lowest Rf value is likely to…
A: Reverse phase chromatography: The chromatographic technique that uses the hydrophobic stationary…
Q: Which of the following are nonessential amino acids in humans? valine aspartic acid proline…
A: Amino acids are monomers of protein they are linked with each other by forming peptide bonds.…
Q: Determine whether the following monosaccharides have D or L configuration and classify them based on…
A: In the d/l system (named after Latin dexter and laevus) molecules are named relating them to the…
Q: Describe the properties of water that are critical to maintaining life Include a discussion of…
A: Water most important element on earth without that life on earth can not be possible , without water…
Q: 6. An organic substance bound to an enzyme and essential for its cavity is called: a. Coenzyme b.…
A: The non-protein factors that are necessary for activity of some enzymes are called cofactors.
Does oxidase, catalyzes the oxidation of molecular oxygen? True or False
Trending now
This is a popular solution!
Step by step
Solved in 2 steps
- The citric acid cycle operates only when O2 is present, yet O2 is not a substrate for the cycle. Explain.Oxygen is not a reactant in the β oxidation of fatty acids. Can β oxidation occur under anaerobic conditions? Explain.Describe the main catabolic pathways and their locations inaerobic respiration.
- Infants do not have the ability to metabolize ethanol and are assumed to lack the enzyme alcohol dehydrogenase? What kind of regulation is this?Beta oxidation generates substrates for cellular respiration through which of the following processes? a. catabolism of proteins b. catabolism of fatty acids c. catabolism of glycogen d. catabolism of glucoseIn cellular respiration, carbon dioxide is formed from the oxidation of which of the following?
- Does the acetyl-CoA required for ketone body synthesis transport through the inner mitochondrial membrane?How many ATPs are produced by the respiratory chain from all the molecules od FADH2 formed from the complete oxidation of one glucose molecule?The end product of glycolysis, pyruvate, cannot enter as such into the citric acid cycle. Which process converts this C3 compound to a C2 compound?