Draw the structure of ß-D-Glucose
Q: D. How many times would you expect to find a specific 20 base pair sequence in the human genome?
A: The total number of base pair sequences in the human genome is 3 billion base pairs or 3 * 109 base…
Q: The fatty acid side chains of the phospholipids in the inner mitochondrial membrane exhibit a large…
A: Since you have posted multiple questions, we will provide the solution only to the first question as…
Q: In oxidative phosphorylation, a chemical agent that prevents the enzymatic activity of F1 would…
A: The correct answer is:c. 1 = Inhibit electron transfer; 2 = Inhibit ATP synthesis
Q: What phosphate buffer conditions can be used to isolate protein (isoelectric point of 5.2) using…
A: Ion exchange chromatography is a process that allows the separation of ions and polar molecules…
Q: the class of enzymes to which it belongs to, ii) name the kind of bond that is modified due to its…
A: Enzymes are proteins that catalyse biochemical reactions. Enzymes show high substrate specificity…
Q: Given the following biosynthesis scheme, answer the questions (a)-(c) below. OH Me C E Me Me SACP OH…
A: For the synthesis of unbranched fatty acids, living beings carboxylate Acetyl CoA to yield malonyl…
Q: What is the buffering range of Solution A? 14 13 12 11 10 9 8 pH 7 6 5 4 3 2 1 Titration curve of…
A: A buffer is a solution that can resist the pH change when a small amount of acid or base is added to…
Q: H3C. H3C N R' N NH =0
A: FAD -Flavin Adenine DinucleotideThe two nitrogen atoms in the isoalloxazine ring are reduced to give…
Q: Question 9 Which of the following statements is NOT correct O Triglycerides are phospholipids…
A: Triacylglycerol (TAG) are also known as triglycerides. Phospholipids are found in the membrane. They…
Q: volume of the quasi-steady-state culture was V0= 500 L, and the nutrient solution containing glucose…
A: For achieving the optimal growth of the microorganisms or cells in culture the quasi-steady state or…
Q: Draw the predominant form of Gly-Gly when 2.0 moles of OH- is added.
A: The net charge of a peptide depends on the pH of the solution and the pKa values of the ionizable…
Q: 11. Anomers can be interconverted ________. A. by an isotopic exchange reaction B. by rotation…
A: Anomers are a specific type of stereoisomers that differ in their configuration at the anomeric…
Q: Which of these compounds undergo keto-enol tautomerism? (Select all that apply.) O CH3CCH3 CH3 CH3…
A: Tautomers are structural isomers of each other. Keto-enol tautomerism is a type of constitutional…
Q: The citric acid cycle consumes oxygen Group of answer choices True False Oxidative…
A: The citric acid cycle consumes oxygen.--- FALSEThe citric acid cycle or the TCA cycle does not…
Q: b. Please draw the structure of the polypeptide: threonine-lysine-glutamine-valine at pH 7.0, and…
A: Amino acid sequences are written with N-terminal amino acid on the left and C-terminal amino acid on…
Q: cells of the working tissue as HCO3 - in the blood
A: Transport of Respiratory Gases :
Q: 92. You have sequenced a short piece of DNA (by chain termination sequencing) and produced the gel…
A: As we know we have to depict the sequence of any amino acid sequence transcribed from 5' end to 3'…
Q: In the following reactions, identify the substance oxidized, the substance reduced, the oxidizing…
A: In some chemical reactions, there is transfer of electrons. The transfer of electrons from one…
Q: (a) (b) O (d) (2) If acetyl-CoA were labeled with ¹4℃ at carbonyl group, and then were used as the…
A: Pyruvate produced as a result of glucose oxidation is oxidised to acetyl CoA via the pyruvate…
Q: 93. Which is a common function for the protein product of a cancer-causing gene? a) a role in DNA…
A: Cancer-causing genes, like the name implies are genes that lead to the development of cancer. We…
Q: 36. Which of the following is true concerning the shown chemical? HO-CH2 O H H HO CH ₂0H OH H A. It…
A: Tautomerization is a type of isomerization reaction in which the carbonyl group interconverts…
Q: Draw a general diagram of a triglyceride. Describe the various types of biologically important…
A: Lipids are a broad group of biomolecules that are characterized by their hydrophobic or nonpolar…
Q: 2. Discuss an enzyme/enzymes that can use different mechanisms action depending environment.…
A: When an enzyme catalyzes a reaction that involves two substrates and after catalysis, there are two…
Q: 11. For a reaction A + B → P +Q, which is catalyzed by an enzyme (E), the following observations are…
A: A)First understand both the mechanismPing-pong mechanism- In this type of reaction proceeds through…
Q: 13. Which of the following is true for the induced-fit model of enzyme-substrate binding? A. The…
A: The induced-fit model of enzymes defines that the substrate binds to the active site of an enzyme…
Q: Glucose + H₂O + 0₂ Glucose oxidase H₂O₂ + 4-Aminoantipyrine + Vanillic acid (colourless) Gluconic…
A: UV spectroscopy, also known as ultraviolet-visible spectroscopy or UV-Vis spectroscopy, is a…
Q: Question: Physical pharmacy 7) Which one of the followings experiments are related to micromeritics?…
A: Micromeritics encompasses the scientific and technological exploration of small particles, which…
Q: What is the net charge for the following peptide at pH = 7 (neutral pH)?…
A: In order to solve this question. First we need to find the ionizable groups in the peptide, as it is…
Q: B. Describe in complete sentences how you would identify a target DNA cleavage site for CRISPR-Cas9…
A: A target DNA cleavage site would have PAM sites - 5' NGG flanking both sides of the target.In the…
Q: and Carbohydrate Metabolis the B vitamins below, indicate w processes each vitamin is involv…
A: Glycolysis is the metabolic pathway by which glucose is converted into two molecules of Pyruvate.…
Q: Treatment with NAD for hangovers: possible? Explain?
A: NAD, or nicotinamide adenine dinucleotide, is a coenzyme found in all living cells. It is involved…
Q: Assume that an inhibitor (I) can bind to an enzyme and is modified by the enzyme. The modified…
A: Enzyme inhibitors are the molecules are the chemical compounds that bind to the enzyme to influence…
Q: What is a Polyglycolic acid
A: Polyglycolic acid: Polyglycolic acid (PGA) is a synthetic biomaterial that belongs to the family of…
Q: Describe the difference between ionic and covalent bonds.
A: Ionic and covalent bonds hold atoms in compounds. Ionic bonds form when atoms share electrons,…
Q: glucose will be more readily phosphorylated by glucokinase than hexokinase hexokinase will…
A: The main difference between the enzymes Glucokinase and Hexokinase is their location. Hexokinase is…
Q: How many acetyl CoA are produced from the complete B oxidation of lauric acid, CH3- (CH₂) 10-COOH, a…
A: β-oxidation is a metabolic process in which fatty acids are broken down into acetyl-CoA molecules…
Q: For biological membranes, which of the following statement is NOT true? A. The phospholipid bilayer…
A: The internal cellular environment is separated from the exterior world by biological membranes,…
Q: You're working in a lab that studies a newly discovered protein called GOT. You have preliminary…
A: Proteins are biomolecules that serve diverse functional roles within a cell. Receptors are proteins…
Q: question 1 : draw an α,α(2, 2) linkage between the two monosaccharides(two fructose ). label the…
A: Glycosidic linkage is the linkage between a carbohydrate with a carbohydrate/non-carbohydrate…
Q: What is the term transamination means in amino acid metabolism? Provide examples; how does it differ…
A: This answer defines "transamination" in amino acid metabolism and contrasts it with oxidative…
Q: 5'-CCGATATAATGAGTCGTCGTCTGGGCCTTCATGTATTCATGGGAAGAGAGTGTAATGTTTGCCTAAGGCC -3 70…
A: As per the central dogma of molecular biology, the genetic information stored in the DNA is copied…
Q: What is the repeating sequence of collagen and how is it essential to the structure of the triple…
A: Collagen is a fibrous protein that is abundantly found in the human body and plays a crucial role in…
Q: Lab, you will need to design your own experiment that detects the nucleic acids from the given list…
A: The NP refers to nucleoprotein of the virus. It can be part of the capsid that encapsulates the RNA…
Q: 2. If glyceraldehyde-3-phosphate dehydrogenase in red blood cells is completely inhibited, which…
A: Glyceraldehyde 3-phosphate dehydrogenase catalyzes the reversible reaction given…
Q: 36. Which of the following is true? A. All proteins possess primary, secondary, tertiary and…
A: The four levels of structure organization in proteins are primary, secondary, tertiary and…
Q: Question based on SDS-PAGEI f you look at your loading buffer, what is the function of…
A: SDS PAGE or sodium dodecyl sulphate polyacrylamide gel electrophoresis is an electrophoresis…
Q: Trend observed in graph and conclusion about the effect of temperature on enzyme activity. i)…
A: Temperature has a large impact on enzymes since it directly affects their activity and the rate of…
Q: The length of a DNA molecule is 680 nm when the DNA molecule is in B-conformation. How many helical…
A: The A-form & B-form are two possible conformations for DNA, the genetic material of living…
Q: Which sugar residues and "glyco-antigens" are discussed to play a role in tumorigenesis,…
A: Glycoantigens are carbohydrates that are attached to proteins or lipids. They are important for…
Q: List three important characteristics of catabolic process
A: Catabolic pathways are metabolic processes that refer to the splitting of bigger molecules into…
Step by step
Solved in 3 steps with 1 images
- Write the linear and ring forms of D-glucose.Draw a simple diagram that shows the connection between the Entner-Doudoroff pathway and the Embden-Meyerhof pathway and the connection between the pentose phosphate pathway and the Embden-Meyerhof pathwaywhat is the difference between glucosidic linkage and glycosidic lingake