FFFN.∙NSOH₂N-`Np-AKTAKTp-GSK3BGSK33p-p70S6Kp70S6Kp-4EBP14EBP1GAPDH Drug X shown below is a kinase inhibitor used to treat multiple types of breast cancer. Breast cancer cells are treated withthe drug and after 8 hr are lysed and the presence of various proteins is shown by a band on a western blot. The presenceof the phosphorylated form of the protein is shown by the presence of a band when probed with antibodies that recognizethe phosphorylated form of protein and are indicated by a p- in front of protein name (e.g. p-AKT). Based on thisinformation, which kinase is likely the target and is inhibited byJustify your answer in 3-4 sentences.Drug X.FFFN.-NSIZH₂N`NNo Drug(+) Drugp-AKTAKTp-GSK3BGSK3Bp-p70S6Kp70S6K

As given in the question, Drug X is a kinase inhibitor used to treat multiple types of breast…

Answered: Drug X shown below is a kinase…

Biology Today and Tomorrow without Physiology (MindTap Course List)

5th Edition

ISBN:9781305117396

Author:Cecie Starr, Christine Evers, Lisa Starr

Publisher:Cecie Starr, Christine Evers, Lisa Starr

Chapter10: Biotechnology

Section: Chapter Questions

Problem 3DID

See similar textbooks

Similar questions

A peptide with the sequence AELQAKSAIAHELQAKAAIAHA is treated with ATP while in the presence of kinase An alpha helix is formed with the phosphorylated at pH 5 In the direction of the helix axis, what is the length of the helix
Certain hormones, such as epinephrine, can increase the levels ofcAMP within cells. Let’s suppose you pretreat cells with or withoutepinephrine and then prepare a cell extract that contains theCREB protein.You then use an electrophoretic mobility shift assay to analyzethe ability of the CREB protein to bind to a DNA fragmentcontaining a cAMP response element (CRE). Describe what theexpected results would be.
Cancers are often caused by overactive growth factor receptor signaling (remember growth factor receptors are enzyme-linked receptor pathways). If you were able to use gene therapy to overexpress a particular protein in a cancer cell, which of the following might be useful to overexpress in order to combatt cancer? a GAP that acts on Ras a phosphatase that acts on GPCR a protein that enhances the activity of Akt a ubiqtuin ligase that acts on the MAPK phophatase
Three different ligands, Ligand Q, Ligand T, and Ligand W, bind to the same protein but with different affinity: The association constant (Ka) for the binding of Ligand Q to the protein is 0.033 nM-1. The fractional saturation (Y) of the protein is 0.20 when the concentration of Ligand T is 1.25 nM. The fractional saturation (Y) of the protein is 0.80 when the concentration of Ligand W is 72 nM. Given this information, Calculate Kd for the binding of each ligand to this protein. Which ligand binds with greatest affinity? Which ligand binds with the lowest affinity?
For each of the following, describe the path the protein takes to its final destination in the cell.Drawings are strongly recommended! If you need more space, you can use a separate sheet ofpaper. Proteins: 1) Hedgehog (released from the signaling cell), 2) Smoothened, 3) Ci/GliYour answers should include the following if they apply for each protein:o Sorting sequences and how the protein knows where to go at each step (what recognizesdifferent sorting sequences/tags). How/when the protein is inserted into the membrane (if it is a membrane protein) What organelles the protein passes through on its way to its final destination. How the protein is transported (vesicles? translocons? etc.), including a role for microtubules.How the protein might be modified in each organelle it passes through. What other proteins are involved in transport and how the system is reset to allow for otherproteins to be transported.
Jack is applyng to Gate's foundation for a grant to make a high affinity, humanized monoclonal antibody that could neutralize venom, a 7 kDa protein of 62 amino aicds, from cobra snakes. He argues that many people in tropical areas are bitten by the poisonous snakes and may need injection of this life-saving anitbody more than once. His friend has successfully purified the 7kDA venom protein expressed in E. coli in a large quantity and will give him whatever he needs for his project. Assume that he recovers four anti-venom monoclonal antibodies. What is the method he can use to identify the one with the highest affinity to the venom?
Jack is applyng to Gate's foundation for a grant to make a high affinity, humanized monoclonal antibody that could neutralize venom, a 7 kDa protein of 62 amino aicds, from cobra snakes. He argues that many people in tropical areas are bitten by the poisonous snakes and may need injection of this life-saving anitbody more than once. His friend has successfully purified the 7kDA venom protein expressed in E. coli in a large quantity and will give him whatever he needs for his project. How can he make anti-venom monoclonal antibodies?
Jack is applyng to Gate's foundation for a grant to make a high affinity, humanized monoclonal antibody that could neutralize venom, a 7 kDa protein of 62 amino aicds, from cobra snakes. He argues that many people in tropical areas are bitten by the poisonous snakes and may need injection of this life-saving anitbody more than once. His friend has successfully purified the 7kDA venom protein expressed in E. coli in a large quantity and will give him whatever he needs for his project. Among more than 100 candidates, what can he do to identify those that recognize the venom?
You plan to synthesize a peptide to be used as a vaccine to treat melanoma, a particularly aggressive form of skin cancer. Normally, gp100, a protein on the surface of melanocytes, activates cell growth when it is bound by its ligand. Activation of the growth pathway depends on the presence of threonine in the ligand. The effective peptide vaccine will mimic the natural ligand, but won’t cause cell growth and division. Below is the sequence of the natural ligand: LDMKTAG In order to ensure your newly designed peptide vaccine does not cause cell growth upon binding, you must substitute the Threonine residue at position 5. What amino acid would you replace it with, bearing in mind that the peptide should still be similar enough to bind to the gp100 protein in the surface of melanocytes. Explain your choice. Your vaccine will be administered as a topical cream, and you require your peptide to have an overall neutral charge in order to be functional. At what pH should you formulate…
An SH2-containing protein contains a mutation that changes its binding pocket such that tyrosine and phosphotyrosine bind with equal afﬁnity. As a result, MEK activity: does not change with receptor dimerization and transautophosphorylation decreases due to changes in Raf activation increases with ligand binding-induced dimerization decreases due to allosteric inhibition of SH2-domain binding
Quorum sensing controls the expression of virulencein many pathogenic bacteria. Usually, pathogens express toxins in response to receptor activation by ligand binding at high cell density. V. cholerae (thecausative agent of cholera) does the opposite; its virulence genes are expressed only at low cell densitybecause its quorum-sensing receptor is repressed byligand binding. The unusual “reversed” mechanismfor activating virulence genes in V. cholerae has suggested to scientists a simple idea for generating a newkind of antibiotic for the treatment of cholera.Explain
Which statements decribe the function of the protein encoded by this gene CAGATTGTGAAGAGGTCTCTTGA? A. Break point cluster region protein that may function as a GTPase B. A coagulation factor C. An enzyme involved in the breakdown of glycosaminoglycans (GAGs) D. Transcription factor involved in the DNA damage response E. A component of hemoglobin F. A tyrosine kinase G. Serine/threonine kinase involved in the DNA damage response H. A tumor suppressor involved in WNT signalling I. A DNA repair enzyme involved in nucleotide excision repair

SEE MORE QUESTIONS

Recommended textbooks for you

Biology Today and Tomorrow without Physiology (Mi…

Biology

ISBN:

9781305117396

Author:

Cecie Starr, Christine Evers, Lisa Starr

Publisher:

Cengage Learning