During plasmid extraction, after the addition of acetate-conta in ing neutralization buffer the large. plasmids can renature and stay in solution. DNA and prote ins precipitate, but the small bacterial DNA O Autosome O Plasmid O Gen omic O Mitotic O Karyotype
Q: How many enyzymatic reactions are there in glycolysis pathway?
A: There are 10 enzymatic reactions in glycolysis pathway.
Q: Fatty acids are synthesized thru a chain of elongation that starts from Acetyl-CoA as the precursor…
A: A fatty acid is a carboxylic acid with a saturated or unsaturated aliphatic chain. The unbranched…
Q: alse about aminoglycosides Can be used in the treatment of tuberculosis O a. O b. They have activity…
A: Antibiotics known as aminoglycosides treat many serious infections caused by gram-negative…
Q: Is it true that there is no such thing as vitamin overdose? For the fat-soluble vitamins, list down…
A: Although dying from a vitamin overdose is exceedingly rare, there were confirmed cases of death due…
Q: Phosphofructokinase (PFK-1) is ____ when ATP levels are low, and ____ when ATP levels are high. a…
A: Phospho Fructo Kinase 1, PFK1 is an important Enzyme of Glycolysis that convert fructose 6 phosphate…
Q: Enumerate the types of carbohydrates unit and explain each
A: A carbohydrate is a biomolecule composed of carbon, hydrogen, and oxygen atoms in a 2:1…
Q: Which of the following is required for RNA splicing to occur? a 2´ hydroxyl group a free 5´…
A: Introduction: Eukaryotic genes often contain intervening sequences called introns that separate the…
Q: Problem 2. Competitive inhibitors are commonly used to make pharmaceuticals. Some cancer drugs act…
A: We need to plot the Lineweaver Burk Plot (LB Plot) to solve this problem. So first we need to find…
Q: (a) Identify a phospholipid from the list of compounds shown above. __________ (b) Identify a…
A: Answers: (a) Identify a phospholipid from the list of compounds shown above. __________ Answer:…
Q: A newly synthesized protein contains a signal peptide on the N-terminus end of its polypeptide…
A: Proteins are a linear chain of amino acid sequences attached together via peptide bonds. There are…
Q: Which of the following is NOT one of the products of the pentose phosphate shunt?
A: The pentose phosphate pathway is the one important metabolic pathways which is take place in most of…
Q: TRUE or FALSE: Lipids may originate through carbocation-based condensation of thioesters or by…
A: Introduction: Lipids are a heterogeneous group of biomolecules that includes fats, oils, waxes,…
Q: Which of the following enzyme(s) is/are present in liver cells? () Glycogen phosphorylase (ii)…
A: Enzymes are highly specialized proteins that have extraordinary catalytic power, greater than that…
Q: 2. Dr. Kim at Research Center performed shotgun Sanger sequencing on an unknown DNA sample, and…
A: In conventional sequencing method, in a reaction mixture, single-stranded molecules of the DNA,…
Q: In the ESTIMATION OF TOTAL SERUM CHOLESTEROL using ZAK AND HENLY’S METHOD, explain why should the…
A: In this estimation method, proteins in serum are precipitated with ferric chloride-acetic acid…
Q: Match the following descriptions with the correct lipid-based compounds:…
A: Lipids are a class of compounds that are insoluble in water and soluble in nonpolar solvents. Lipids…
Q: What is hydatid cyst disease? What complication/s can occur? What is cysticerosis? How is it…
A: A disease is described as a particular abnormal condition that has a very negative effect on…
Q: explain why is the importance of pharmacogenetics in the world of forensic sceicn
A: Introduction: Pharmacogenetics is the study of how genetic differences in a single gene develop…
Q: What forces contribute to the folding of a polypeptide? Can you explain the reasoning too?
A: The folding of a protein into its proper three dimensional structure is necessary for attaining the…
Q: Biological value
A: Protein efficiency ratio: It is defined as a ratio of weight gain of a subject to protein intake.…
Q: Some enzymes require additional ...........................to catalyze reactions effectively. These…
A: Introduction: Enzymes are large biological molecules important for thousands of metabolic processes…
Q: Which of the following steps does NOT require ATP? O A. Conversion of glucose to glucose 6-phosphate…
A: Metabolic pathways are a series of process which includes chemical reactions occurring in a cell.…
Q: Why marathon runners eat a meal rich in carbohydrates the day before the race
A: Nutrients are molecules that aids in the growth and development of living organisms. Nutrients are…
Q: 87) For a the viral proteins a. If the viral protein is made in the RER, it will go back to the…
A: Proteins are composed of amino acids, which are bound together by peptide linkage. Amino acids…
Q: If we wanted to measure the BSA absorbance without the Biuret reagent, which wavelength would we use…
A: BSA means bovine serum albumin. BSA is a protein and proteins are composed of twenty standard amino…
Q: plasmid cloning vector
A: The term vector refers to the DNA molecules that act as transporting vehicle which carries target…
Q: A transversion mutation would be replacing T by: a. C b. T c. either A or G d. U
A: Transversion mutation is a type of substitution mutation. A gene mutation that results from the…
Q: Spliceosomes include all of the following EXCEPT enzymes catalyzing acetylation of histone…
A: Introduction: The splicing of RNA occurs by a large complex known as the spliceosome. It contains…
Q: what are the dietary fats, and what are the dietary fat food and calorie densed beverage that lead…
A: Fats are made up of glycerol and fatty acids. Fats are classified into two types, saturated and…
Q: 97) In order for a retrovirus to be infectious a. The p25 protein is cleaved by the protease enzyme…
A: Introduction: Retroviruses are a family of viruses that are grouped together based on how it is…
Q: Match the following methods of Analysis v Fractional analysis, methylation, and periodate oxidation…
A: The Biochemical analysis techniques are a set of methods, procedures and assays. This enables…
Q: Question 11 Match the different carbohydrates' nomenclaturel glycan representation with their…
A: There are 4 biomacromolecules; Proteins, Nucleic acids, lipids and carbohydrates. The polymer…
Q: Which is true about eukaryotic cDNA? Choose all that apply. a. it is constructed from mRNA that…
A: In the laboratory, complementary DNA (cDNA) is made from messenger RNA. Because the transcript of…
Q: Which of the following is NOT produced during the oxidative phase of the pentose phosphate shunt? a…
A: Pentose phosphate shunt is a metabolic pathway that is involved in the synthesis of pentose sugar…
Q: BRIEFLY EXPLAIN their BIOLOGICAL SIGNIFICANCE of Cellulose and Chitin
A: Polysaccharides consist of repeated units of monosaccharides or the derivatives of monosaccharides…
Q: Use the Michaelis-Menten equation to complete the enzyme kinetic data set, when Km is known to have…
A: Introduction: The theory of enzyme kinetics was proposed by two scientists Leonor Michaelis and…
Q: Dietary factors associated with increased risk for obesity are increased dietary fat intake and…
A: Obesity and overweight occurs when the amount of calorie that we take via food exceed the bodies…
Q: On average, 180 liters of plasma are filtered each day. A If humans had to expend one molecule of…
A: An important "energy molecule" found in every living organism, adenosine 5′-triphosphate is…
Q: Question # 1: A shampoo bottle lists "partially hydrolyzed protein" as one of its ingredients. What…
A: Almost every hair product on the market today contains protein in some way or another. Protein…
Q: draw the full equation for this triacylglycerol undergoing saponification, using KOH.
A: In the process of saponification, triglycerides are reacted with sodium or potassium hydroxide to…
Q: How do eukaryotic and prokaryotic RNA polymerases compare? a. Since eukaryotic RNA polymerases are…
A: Transcription in prokaryotes and eukaryotes is different in many aspects. Eukaryotic transcription…
Q: Is there a significance in studying the gene structure? Why or why not?
A: Gene is basic heridity unit organisms from which parental characteristics transfer to their childs…
Q: What is the name of the molecule when glucose is bound to hemoglobin? a. Glycohemoglobin b.…
A: Hemoglobin is an iron-containing oxygen-transport metalloprotein located in almost all vertebrate…
Q: Glucose transporter allows glucose to move only in one direction to prevent loss from the cells.…
A: Permeability barrier and semi permeability of cell membrane are both maintained by lipids.…
Q: From a hospital patient affected with a mysterious illness, cells were isolated, cultured and…
A: In human and all almost organisms, DNA or deoxyribonucleic acid is the hereditary material. DNA is…
Q: hain elongation of monosaccharides can be done in the laboratory thru Ruff reaction. True False
A: The Ruff degradation is the process of converting an aldose to its analogue with one less carbon…
Q: Why is it important to study or familiarize the levels of protein structure?
A: Proteins are polymers of amino acids linked by peptide/amide bonds. Levels of protein structure are…
Q: What amino acid side chains can be modified by methyl groups? What is unusual about methyl group…
A: What amino acid side chains can be modified by methyl groups? Answer: Methylation is a process of…
Q: Amanufacturer of a line of patentmedicines is preparing a production plan on medicines A and B.…
A: Decision variable: A = bottles of medicine A (1000 units) B = bottles of medicine B (1000 units)…
Q: rans configuration) (3) linoleic (18:2) (4) stearic (18:0) (5) palmitic (16:0) 5 >…
A: The melting point of fatty acid was influenced by the degree and length of the hydrocarbon chain.…
Step by step
Solved in 3 steps
- A linear DNA fragment and a plasmid has three restriction sites for EcoRIhow many fragments will be produced from linear DNA and plasmid respectively.A student wanted to load .75 ug dna on agarose gel and has 4x loading buffer for sample preparation. The student has 50ul purified plasmid, finding concentration of plasmid to be 250 ng/uL The student used 10uL plasmid DNA in 50uL reaction for the restriction digest Give the volumes of restriction digest and 4x loading buffer that student would mix together and load on agarose gel.83. A plasmid is cut with the restriction enzyme BamH1 giving fragments of 3000 and 1000 bp as identifiedby gel electrophoresis and ethidium bromide staining. In a seperate restriction digest the enzyme EcoR1gives fragments of 1000 and 1500 bp that are apparent on the agarose gel. What is the most likely size ofthe plasmid in bp? Explain why it's 4000
- During conjugation, an enzyme callled _______ will nick one strand of the F plasmid at the ______ site after which the ssDNA moves to the recipient cell. The original cell ____________ the F plasmid in this process. Select one: a.endonuclease/ OriT/Loses b.ligase/ OriC/ Loses c.endonuclease/ OriT /Maintains d.HaeIII/ OriC /Maintains e.None of the AboveRecombinational repair is often due toa) Incorporation of many incorrect nucleotides by DNA polb) Many cystidine dimer and associated large gaps in a strandc) Many thymidine dimer formation and associated large gaps in a strandd) All of theseA researcher has a Trp− auxotrophic strain of E. coliwith a mutation in a single gene. To identify thatmutant gene, she uses a genomic library made from a wild-type version of that same strain to find plasmids that rescue the mutant phenotype. The result issurprising. She recovers 10 plasmids that provide aTrp+ phenotype, but six of the plasmids contain geneX, while the other four contain gene Y. Our scientisthas encountered a phenomenon called multicopysuppression, related to the fact that plasmids are usually present in several copies per bacterium. Becausethe genes in the plasmids are present in more thantheir usual single copy in the bacterial chromosome,more than the usual amount of Protein X or Protein Yis being produced from the plasmids. Sometimes,overexpression of one protein can rescue the mutantphenotype caused by loss of a different protein.Suggest at least two ways that our scientist could determine which of the two genes, gene X or gene Y, actually corresponds to the…
- You isolated a 10,500 base pair plasmid (supercoiled, cccDNA) from E. coli. The plasmid contains one unique recognition site for EcoRI, a restriction enzyme. Restriction enzymes recognize a specific sequence and cut both strands of the DNA at that sequence (Chapter 7). Brief DNase I treatment breaks one (or very few) phosphodiesterbonds in each DNA molecule, leaving the double-stranded DNA with one strand broken but the other strand intact, i.e “nicked.” You briefly incubated the cccDNA at 37°C in four separate reactions containing the components listed below. You ran each reaction sample on an agarose gel and visualized the DNA using ethidium bromide and UV light. The reactions included the appropriate buffer and ATP when required. An agarose gel containing four lanes of possible products is given below. Please refer to Figs. 4-26 and 4-27 in Watson for reference. For each reaction, indicate which lane of the gel contains the products that you would expect to see on your…You digest 4 uL of plasmid DNA that is 50 ng/uL concetration in a total volume of 20 uL. You run 10 uL of the digest on teh gel. You then do a DNA purification protocol with a Zippy prep on the remaining digested DNA. You elute the DNA in a 25 uL. A 2 uL ssample has the concentration of 2 ng/uL. What is the DNA yield?#2 EcoRI --- 5’ G ↓AATTC 3’ 5’ ACG ACGTATTAGAATTCTTA TCCGCCGCCGGAATTCT CATCA 3’ 3’ TGC TGCATAATCTTAAGAATAGGCGGCGGCCTTAAGAGTAGT 5’ Restriction enzyme: Recognition sequence: Number of pieces of DNA: Type of cut:
- Below is shown a plasmid map from a recombinant DNA experiment you have performed. You inserted your gene of interest (labeled gene on the map) into the lac Z reporter gene via a Hind III site. If you digested this recombinant DNA with HindIII what is the size of the DNA fragment(s) you would obtain on a DNA gel electrophoresis? The plasmid alone is 4000 bp. I have attached the image below.After plasmid isolation, you take 0.5 uL of the sample and mix it with 1 uL of TE buffer. The absorbance of this sample at 260 nm is 0.8 and the average extinction coefficient of double-stranded DNA at 260 nm is 0.020 (μg/ml)−1 cm−1. What is the concentration of the undiluted sample? 120 μg/mL 80 μg/mL 40 μg/mL 12 μg/mLConjugation using ________ will result in the transmission of a segment of chromosomal DNAfrom one host to another using a plasmid. Question 25 options: F‑strain High frequency recombination (hfr) strain F+strain F plasmid F' plasmid
