How do eukaryotic and prokaryotic RNA polymerases compare? a. Since eukaryotic RNA polymerases are more complex, no homology has been found between the actual protein sequences in the catalytic subunits. b. Since eukaryotic transcription is less complex than in prokaryotes, monomeric, single polypeptide RNA polymerases are used. c.Despite their added complexity, eukaryotic and prokaryotic RNA polymerases are generally homologous and share some conserved sequences d. Eukaryotic and prokaryotic RNA polymerases are virtually identical.

Q: Diets aimed at reducing coronary heart disease should be: low in trans-fatty acids and high in…

A: Coronary heart disease occurs when the blood supply of the heart is blocked due to build-up of fatty…

Q: Which fatty acid has the highest melting point?

A: Fatty acids are  one of most important component in living organisms. It is building blocks of the…

Q: What are the different applications of Gel Electrophoresis?

A: The variation in size and charge of distinct molecules in a sample is exploited by the gel…

Q: considering mating a black hearing male Labrador dog (homozygous in both alleles) with black deaf…

A: According to the given question, the male is black hearing Labrador dog and is a type of a…

Q: 4. Which of the following is an example for group specificity? a) Trypsin hydrolyzing peptide…

A: Group specificity - It implies that the enzyme will catalyze a particular reaction on the function…

Q: Which among the following statements is correct? O lon-exchange chromatography is dependent on the…

A: Introduction: Chromatography is an analytical technique for the separation of different dissolved…

Q: Which of the following is the correct order of mechanism of how sugar is perceived?   Signal…

A: Glucose is a monosaccharide and it is a simple sugar that is the most important source of…

Q: running the reaction at 83 °C cooling the reaction to 11 °C changing the pH to 5.4 Increase reaction…

A: The rate of an enzyme catalyzed reaction depends on various factors like temperature and pH of the…

Q: e. 92 sister chromatids

A: In eukaryotes, two types of cell division partition the genetic material into progeny or daughter…

Q: etabolism as a determinant of bioavailability: the first-pass effect

A: Bioavailability is the rate and a particular range of the active ingredient absorption , when it…

Q: In which type of segregation, genetic information is gained? Alternate Adjacent Both None

A: Principle of Segregation genes explains how pairs of gene variants are separated into reproductive…

Q: Which of the following viruses have been used as vectors for gene delivery?

A: Gene delivery is a process of introducing the foreign genetic materials which are DNA and RNA into…

Q: 3. A biochemist purified a protein from the bloodstream and determined its molecular weight under…

A: The quaternary structure of a protein describes the association of polypeptide chains or subunits…

Q: Match general features of each blood groups in column A with the blood types in column B.…

A: Blood Group A- Contains N-acetyl glucosamine Blood group B - Contains galactose Blood group O-…

Q: Why most of the clinical features of the diseases Krebs Cycle inborn errors ( a- ketoglutarate…

A: Krebs cycle : This pathway plays an important role in the living cell metabolism also known as…

Q: You would like to identify the protein subunits in a macromolecular complex. What kinds of…

A: Proteins are the building blocks of aminoacids. The kind, amount, and sequence of amino acids that…

Q: Restriction digestion of DNA fragments is not sequence specific. True False

A: Within a few years after discovering EcoB, EcoK, and HindII, scientists were already experimenting…

Q: What is the possible drug interaction in the following structure of phenoxybenamine?

A: Phenoxybenamine is a haloalkylamine drug which is used to treat hypertension. Haloalkylamines does…

Q: Loss of function mutation results in a _ allele.

A: Mutations are sudden changes in the gene sequence. When these changes causes loss of function of an…

Q: Draw the general structure of a phospholipid.

A: The phospholipids are the major constituent of the plasma membrane and the chemistry of…

Q: How many ATP couny after complete oxidation 1 mol glucose

A: Metabolism includes biosynthesis/ reduction (an anabolic process) and oxidation (catabolic…

Q: As the strands are synthesized in replication, which of the following is true?

A: The process of in which DNA molecule produce exact copy or replica of itself is known as the…

Q: What is cryopreservation? How do we reduce the risk of cell damage from osmolytic pressure in…

A: Cryopreservation is primarily used to preserve biological specimens. Individual cells and biological…

Q: What is a Ramachandran Plot?

A: Ramachandran plot is developed by G N Ramachandran, C Ramakrishnan and V Sasisekharan in 1963. This…

Q: Q2: What is the theoretical oxygen demand of sucrose 1.25 g/L solution? Write down the…

A: Theoretical oxygen demand : It is abbreviated as TOD. It is defined as the calculated amount of the…

Q: J A positive result for Fohl's test is the formation of a black precipitate in the form of lead. O A…

A: Fohl's Tests - This test is performed to detect the presence of amino acid which containing sulfur.…

Q: Which of the following statements is TRUE regarding the ABO blood system?     People who have the…

A: There are 4 main blood groups A, B, AB and O and each of these groups can be either RhD positive or…

Q: xplain how the color change occurs with the biuret reagent in the presence of proteins

A: In proteins two adjacent amino acids are linked via peptide bond that is formed between the α amino…

Q: Why picric and tannic acid is used for the treatments of burn. Explain this in the concept of…

A: Tannic acid and picric acids are phenolic compounds. These are water-soluble compounds…

Q: Which of the following enzyme is responsible for the regulation of biological nitrogen fixation? A.…

A: Nitrogen fixation is biochemical process by which molecular form of nitrogen with triple covalent…

Q: A monosaccharide that consists of 5 carbon atoms, one of which is in a ketonegroup, is classified as…

A: Monosaccharides are simplest unit or basic unit of carbohydrate. general formula is CnH2nOn. it can…

Q: Which of the following is the polyadenylation signal sequence? AAAAAA O AAUAAA O AAAUAA AAUUAA

A: Polyadenylation signal sequence :- is the signal sequence needed to add poly A tail at 3' end of…

Q: Blood type O is also known as universal donor because it does not contain plasma antibodies.  True…

A: Depending on the presence or absence of antigen or antibodies, the blood has been categorised into…

Q: What are the diseases a-ketoglutarate dehydrogenase deficiency, succinate dehydrogenase deficiency,…

A: ketoglutarate dehydrogenase:  This is the enzyme that catalyses the conversion of alpha keto…

Q: If we wanted to measure the BSA absorbance without the Biuret reagent, which wavelength would we use…

A: BSA means bovine serum albumin. BSA is a protein and proteins are composed of twenty standard amino…

Q: Lipids are soluble in --- and insoluble in ---, respectively.   Question 3 options:   organic…

A: Lipids contain many diverse groups of compounds that are mainly nonpolar in nature. Lipids are made…

Q: dehydrogenase, which converts pyruvate to lactate in the presence of NADH. The velocity of the…

A: Kcat is also known as catalytic constant or turnover number. It can be defined as the amount of…

Q: Name FOUR polymers in your body right

A: Polymers are composed of many monomers attached together via covalent bonds. Polymers are made up of…

Q: Make an analysis of the electrophoresis data below. Comment on the purity, number of subunits, and…

A: Native gel electrophoresis is the process of separation without adding any denaturing agent like…

Q: Explain the Glycolysis and Kreb’s Cycle metabolic pathways.

A: Metabolic pathways in biochemistry are series of chemical reactions takes place which are linked…

Q: List possible glucogenic products of amino acid degradation

A: Aminoacids are classified into two types based on their fate of conversion to glucose or ketone…

Q: Identify the polar and nonpolar parts of the assembly. Identify the pocket and the two bilayers that…

A: Polar components are those that are hydrophilic and soluble in water. Non polar components are those…

Q: In energy production, cells make use of carbohydrates first, lipids second, and proteins (in cases…

A: In process of digestion, complex molecules are converted to simple molecules with the…

Q: Genetically modified cotton plants produce the toxin encoded from the gene originated from the…

A: Any organism whose genetic material has been altered using genetic engineering techniques is…

Q: Which biomolecules contain nitrogen?

A: The four classes of biological macromolecules are: nucleic acids, proteins, lipids and…

Q: Question 8 Which of the following IS a Phase Il metabolic reaction? O Fornation of a ketone at a…

A: Question 8 ans:  Phase l metabolism is when a parent drug is converted to polar active mrtabolite…

Q: H1. Estimate the TKN associated with a sample having 50 mg/L of cell tissue and 10 mg/L of ammonia.…

A: TKN (Total Kjeldahl Nitrogen) test is a method of estimation of total concentration of organic…

Q: Given below is the DNA template. What are the gene products? 3’ TACCGGCCTATCTAGGGCCATGGCTTAATTCCC 5’…

A: DNA is the sequence of Nucleotides that are transcribed into mRNA during transcription. Once DNA is…

Q: A buffer can protect against changes in pH when hydrogen ion or hydroxide ion is added to a reaction…

A: Buffer solution is two types, Acidic buffer - this is composed of a weak acid and it's conjugate…

Q: Enzyme: Crystal Structure of Wild-Type Human Phosphoglucomutase-1 (PGM1) the description of the…

A: The enzyme PGM1 is very well known for its central role in specific human metabolism, where it…