please answer E and F asap please AUGfMetAla4. Above is a sketch of a bacterial ribosome beginning synthesis of a protein chain.A) Label the 5' and 3' ends of the mRNA and the two tRNA molecules.B) Using the genetic code table, write in all of the possible codon sequences in each box on themRNA.AUG.C) In the space below, write all of the possible anticodon sequences for the each of the codonsequences given in part B. For each anticodon sequence, indicate the 5' and 3' end.D) Circle the position of the codon/anticodon pair that would be expected to have the mostpermissive base pairing interaction. What is the name used to describe the flexible interactionbetween the codon and anticodon at this position?E) In the drawing above, indicate the position of features in the mRNA that determines the start ofprotein synthesis. Indicate the position of feature(s) in the ribosome that determine the start ofprotein synthesis and label this feature.F) How would the sketch, including your answers to parts A-E of this question, need to be changed ifthe sketch was illustrating a eukaryotic ribosome?

Introduction Translation involves the syntheisis of proteins by reading the codons on mRNA by tRNA…

E) In the drawing above, indicate the position of features in the mRNA that determines the start of protein synthesis. Indicate the position of feature(s) in the ribosome that determine the start of protein synthesis and label this feature. F) How would the sketch, including your answers to parts A-E of this question, need to be changed if the sketch was illustrating a eukaryotic ribosome?

E) In the drawing above, indicate the position of features in the mRNA that determines the start of protein synthesis. Indicate the position of feature(s) in the ribosome that determine the start of protein synthesis and label this feature. F) How would the sketch, including your answers to parts A-E of this question, need to be changed if the sketch was illustrating a eukaryotic ribosome?

Biology 2e

2nd Edition

ISBN:9781947172517

Author:Matthew Douglas, Jung Choi, Mary Ann Clark

Publisher:Matthew Douglas, Jung Choi, Mary Ann Clark

Chapter16: Gene Expression

Section: Chapter Questions

Problem 20RQ: A scientist mutates elF-2 to eliminate its GTP hydrolysis capability. How would this mutated form of...

See similar textbooks

Similar questions

A scientist sequencing itiRNA identifies the following strand: CUAUGUGUCGUAACAGCCGAUGACCCG What is the sequence of the amino acid chain this itiRNA makes when it is translated?
Refer to the DNA sequence provided: 3’ -TACTGAAGCGGCAGCCCCGCATGAGTAGACCTTACT-5’ a. What is the mRNA transcript of the anticoding strand of the DNA model? b. What is the amino acid sequence of the polypeptide chain that will be translated from the mRNA in (a)?
13b which amino acid would be carried by a tRNA with the anti-codon 5AAG3?
Please determine the order of aminoacids from a given genetic code? 5’-UGGUACGGUACUCCAC-3’
Consider this short mRNA: 5’ – AUGGCAGUGCAA – 3’. Answer the following questions assuming the code is non-overlapping. How many codons are represented in this oligonucleotide? If the second G were changed to a C, what would be the resulting amino acid?
1d) What amino acid would a tRNA with the anticodon 5'AGG3' carry?
Microb an mRNA molecule has the sequence 5'UCA GAA AUG CAC3. Which of the following best describes the tRNA that binds to the third/3rd codon of this mRNA? has anticodon AUG and the amino acid tyrosine It can have any anticodon and any amino acid Has the anticodon UAC and the amino acid methionine Has the anticodon CUU and the amino acid glutamic acid must have the anticodon TAC Has anticodon UUC and the amino acid lysine
1. If the gene above is transcribed into a functional mRNA, a.) how many codons will be carried by the functional mRNA? b.) what is the sequence of the 25th codon? c.) what is the sequence of the stop codon? 2. If the mRNA transcribed for this gene will be translated into a functional protein, a.) how many amino acids will be used to build the polypeptide chain? b.) what is the amino acid coded by the 25th codon? c.) what is the amino acid coded by the last codon? 3. If the above gene is one of the three structural genes of the lac operon that codes for the protein/ enzyme responsible for breaking lactose into two molecules of simple sugars, a.) what triggers the activation of this gene? b.) what triggers the inactivation of this gene? c.) what substance is attached to the operator region of the operon in the absence of activator? d.) what gene is responsible for the synthesis of the substance used to attach in the operator region in the absence of activator? e.) what…
1. If the gene above is transcribed into a functional mRNA,a.) how many codons will be carried by the functional mRNA?b.) what is the sequence of the 25th codon?c.) what is the sequence of the stop codon?2. If the mRNA transcribed for this gene will be translated into a functional protein,a.) how many amino acids will be used to build the polypeptide chain?b.) what is the amino acid coded by the 25th codon?c.) what is the amino acid coded by the last codon?
Refer to the DNA sequence provided:3’ -TACTGAAGCGGCAGCCCCGCATGAGTAGACCTTACT-5’a. What is the mRNA transcript of the anticoding strand of the DNA model?
In the absence of cladosporin, explain the initiation steps in the synthesis of lysyl-tRNA synthetase enzyme or protein in the bacterial cell, with the involvement of all initiation factors, each site in the ribosome, any important conserved sequence, subunits of ribosomes, initiation codon, charged tRNA containing what amino acid, whether it requires ATP or GTP
Consider the following DNA template: 5’-AAGAGGTTCCAATGCAGGCACTCACCAACTCTTAAATAAA-3’ 3’-TTCTCCAAGGTTACGTCCGTGAGTGGTTGAGAATTTATTT-5’ If the bottom DNA strand is used as template to transcribe mRNA, predict the amino acid sequence that would result from the process of translation. Met-Ala-Leu-Thr-Gln-Glu-Gly Met-Gly-Ser-Leu-Asn-Ser-Gln Met-Thr-Asn-Ser-Leu-Ala-Gln Met-Gln-Ala-Leu-Thr-Asn-Ser Met-Glu-Ala-His-Trp-Ser-Tyr