Microb an mRNA molecule has the sequence 5'UCA GAA AUG CAC3. Which of the following best describes the tRNA that binds to the third/3rd codon of this mRNA? has anticodon AUG and the amino acid tyrosine It can have any anticodon and any amino acid Has the anticodon UAC and the amino acid methionine Has the anticodon CUU and the amino acid glutamic acid must have the anticodon TAC Has anticodon UUC and the amino acid lysine

Q: A. The double-stranded DNA sequence for a bacteria is shown below and it's coding for a hypothetical…

A:

Q: Which mRNA strand is complementary to this template DNA strand: 5’-CTGCAT-3’? 3’-AUGCAG-5’…

A: Template strand is the strand of DNA molecule on which the mRNA is synthesized. Complementary strand…

Q: Look at the m-RNA message below: PUT A NUMBER under each of the t-RNA/amino acid complexes to show…

A: DNA( deoxyribonucleic acid) is the double-stranded molecule that is the genetic material in most…

Q: When RNA polymerase transcribes DNA, only one of the two DNA strands is used as a template.…

A: Transcription is the process in which a DNA strand gets transcribes into RNA by the help of RNA…

Q: Which of the following statements about eukaryotic RNA is true? O Exons are spliced together. OA…

A: Exons are spliced together True - Splicing is defined as a process in which the introbs , the non…

Q: 6)Select ALL of the following that apply to transcription. Select one or more: a. occurs in the…

A: Transcription is that the method by which the information during a strand of deoxyribonucleic acid…

Q: D. Evaluation (Pagtataya) • Fill in the pill-shaped bubbles in the flowchart using the terms in the…

A: This is the description of gene expression in which a part of the gene is expressed into a…

Q: Dystrophin gene structe 3 T Elijah's X G Promoter Exon 19 Exon 52 Intron Exon 53 T Liam's X affected…

A: The gene is the sequence of nucleotide that encode a particular protein.

Q: 1. Write the complementary coding strand sequence 5' GGG ATG TCA CAC ATA TTT 2. Write the mRNA…

A: The coding strand of DNA is the one that contains the instructions for the gene in concern. The…

Q: AKS 5c1: Use the model below to answer the question that follows. Which interpretation of this model…

A: Cell is a structural and functional unit of living organisms. Several cells joined together to form…

Q: 2. Use the MRNA sequence to find the DNA sequence and the amino acid sequence. DNA MRNA-…

A: Nucleic acids are present inside the nucleus to store and pass genetic information and thus control…

Q: A gene affecting the behavioral outlook of individuals was discovered in several humans who can…

A: Transcription is the process of the formation of RNA from DNA. Through transcription, the…

Q: 5. You're working in Marshall Nirenberg's lab, trying to decipher the genetic code. You use several…

A: Introduction Marshall Nirenberg discovered a way to determine the sequence of the letters in each…

Q: 1. Transcription: Write out the sequence of mRNA that would result from transcription of the…

A: The flow of genetic information from DNA to RNA, RNA to protein synthesis is called central dogma.…

Q: Consider this short mRNA: 5’ – AUGGCAGUGCAA – 3’. Answer the following questions assuming the code…

A: DNA or deoxyribonucleic acid undergoes transcription and produces messenger RNA sequence in the form…

Q: Consider a human lover cell vs a cheek cell: Explain whether the following components are…

A: Introduction: Transfer ribonucleic acid (tRNA) is a type of RNA molecule that helps decode a…

Q: What is the guide RNA for?     It is an RNA sequence that binds to a DNA 5'-NGG sequence where N…

A: CRISPR-Cas9 is a component of the bacterial immune system. The term CRISPR stands for clustered…

Q: Here is the sequence of a portion of a bacterial gene. The template strand is on the bottom:…

A: DNA and RNA are nucleic acids present in the organisms. DNA is the deoxy-ribose nucleic acid whereas…

Q: 91 The mRNA Shine-Dalgarno sequence interacts with 26S rRNA anti-Shine-Dalgarno sequence. Yes or…

A: Transcription is the process of RNA synthesis from the DNA template. It occurs within the nucleus of…

Q: AKS 5c1: The model below shows the process of protein synthesis. What is the best explanation for…

A: DNA (Deoxyribonucleic acid) is the hereditary material present in most of the living organisms,…

Q: A gene affecting the behavioral outlook of individuals was discovered in several humans who can…

A: DNA acts as genetic material in most organisms. DNA gets transcribed into mRNA by an RNA polymerase…

Q: Hello, my question is in the picture below. Thank you in advance!

A: Transcription is the process of converting DNA into m-RNA in the presence of enzyme RNA polymerase.…

Q: Fill in the blanks: is the term used to describe the genetic coce because the rules that relate the…

A: The genetic code is a set of rules that determine how the genetic information from four-letter codes…

Q: The coding DNA strand of a gene has the following DNA sequence:  5’ ATGGCGACGATAATGTTGTGTGAGTGA 3’…

A: Answer: Central Dogma : It is the complete procedure of replication , transcription and translation…

Q: emist 19.The last codon sequence in place on a strand of mRNA when a protein is being synthesized at…

A: The process by which mRNA is translated to the amino acid sequence is termed as translation. It…

Q: A. The double-stranded DNA sequence for a bacteria is shown below and it's coding for a hypothetical…

A: Transcription is the process where mRNA will from form DNA, then mRNA will from protein in…

Q: What is the effect of the insertion of a nucleotide in the 4th codon of the DNA sequence below?…

A: There are two strands of DNA :- template and coding strand . Template strand read in 3' to 5'…

Q: Antibiotics that selectively inhibit bacterial growth exploit differences between bacterial and…

A: Antibiotic action that selectively functions on inhibition of cellular activities of the bacterial…

Q: cion 18 latch Column A with Column B. v transports amino acids to the site of protein synthesis A…

A: The ribonucleic acid consists of a single stranded structure which consists of a ribose sugar. It…

Q: Here is the sequence of a portion of a bacterial gene. The template strand is on the bottom:…

A: DNA and RNA are are nucleic acids present in the organisms. DNA is the deoxy ribose nucleic acid…

Q: Cells can control or regulate the amount of a particular proteins that is produced by using small…

A: RNAi (ribonucleic acid interference) is also known as gene silencing. It is a biological process…

Q: B- TRANSCRIPTION 1. Use the DNA code provided to copy an mRNA message. (DNA) a. TAC GGA CAT (DNA) b.…

A: The central dogma explains that the information from the DNA will be passed in a sequence fashion…

Q: In Worked Example 26.4, we derived the mRNA sequence of nucleotides shown. What is the sequence of…

A: Translation is a process which involves the synthesis of an amino acid chain from an mRNA sequence.…

Q: BONUS: Within a cell, positive sense single stranded RNA acts as O FRNA O SİRNA tRNA O MRNA

A: Introduction: Positive-strand RNA viruses or +ssRNA viruses are a group of viruses that are related…

Q: A. Consider the following DNA sequence (coding strand) located near the middle of the coding region…

A: Answer option  ll will result in shorter strand

Q: Which statement about transfer RNA (TRNA) is NOT correct? Select one: O It folds up into the shape…

A: Transcription in the process which is responsible for synthesis of RNA from the template strand of…

Q: The double-stranded ONA sequence for a bacteria is shown below and it's coding for a hypothetical…

A: The antisense strand of the DNA sequences acts as a template for the synthesis of mRNA molecule by…

Q: CTA GCC CTC CGT TAC TAG TTA CCT ACT TAT TCA ATT TTG TAA ACG CTC ATC CGA ACC CGC TTT TAA TTG CCC ACT…

A: mRNA molecule-- GAU CGG GAG GCA AUG AUC  AAU GGA UGA AUA AGU UAA AAC AUU UGC GAG UAG GCU UGG GCG AAA…

Q: With respect to wobble hypothesis all of the following are correct except: An inosine nucleotide in…

A: The translation process is started by ribosomes. Ribosomes are made up of bigger and smaller…

Q: Matching type Choices are in the picture 1. simultaneous and rapid process producing mRNA and…

A: DNA instructs everything in the cell and is expressed in the form of proteins coded by DNA itself.…

Q: The following diagram describes the mRNA sequenceof part of the A gene and the beginning of the B…

A: mRNA is a transcribed by the process of transcription from the template DNA strand that codes for…

Q: 3. Below is the sequence of DNA template for transcribing a segment of mRNA. 5 ATGTGGTTATAGCTAACC 3…

A: In the question, we must write the complementary base of the sequence. Our mRNA sequence will be in…

Q: Based on the electron micrograph shown, which of the following statements is/are correct/true?…

A: Introduction :- Microorganisms, cells, big molecules, biopsy samples, metals, and crystals are among…

Q: 5’ UGG CAA UCC UAC GAU 3’   Write out the sequence of the anticodon in the tRNA that would bind to…

A: Note: As per the guidelines only one question has to be answered. Please ask the other question…

Q: Here is the sequence of a portion of a bacterial gene. The template strand is on the bottom:…

A: DNA consists of two intertwined polynucleotide strands: coding strand and template strand. The…

Q: Indicate the mRNA sequence, coding sense DNA sequence and template DNA sequence that produced the…

A: Though it is easier to decide the sequence of amino acids from a given segment of either DNA (any…

Q: Which of the following changes may cause a gene product to not loose functión? Prevent or reduce…

A: Introns and exons are found in the mRNA transcripts and introns are removed via the RNA splicing…

Q: Transcription occurs along a_template forming an MRNA in the _direction. * O none of the above O 5'…

A: The central dogma explain how the DNA codes for the proteins which proceed in three stages namely…