E. coli replication on the lagging strand O is carried out by DNA polymerase I O is initially synthesized as Okazaki fragments O is synthesized continuously has this DNA strand synthesized in a 3' → 5' direction
Q: *Give an example, taken from digestion, glycolysis, gluconeogenesis or the citric acid cycle of each…
A: Let us first understand the following terms: Feedback inhibition: It is a type of regulation or…
Q: 3. Why can DNA adopt both A- and B- forms, while RNA is restricted to the A-form?
A: DNA is two strands of polynucleotide linked to each other in an antiparallel direction by hydrogen…
Q: all of the following statements about mitochondrial oxidative phosphorylation are true EXCEPT a. The…
A: The metabolic pathway in which cells use enzymes to oxidize nutrients, releasing chemical energy and…
Q: Consider the image of protein synthesis (translation). Identify the two different RNA molecules…
A: Translation refers to the process of protein synthesis. It falls under the process of gene…
Q: draw a guanine nucleobase and label all possible H bond donor and H bond acceptor?
A: H bond donor are those groups containing a H bonded to a electronegative atom (F,O,N) and H bond…
Q: What are the components of cephalins? Glycerol Two fatty acids Phosphoric acid Serine All of the…
A: Lipids are a very important class of biological molecule. Lipids can be classified into 2…
Q: Why is it more accurate to call the pathway that converts acetyl-CoA to COA + 2 CO₂ the citrate…
A: The pathway that converts the acetyl coA to coA and carbon dioxide is called citric acid cycle or…
Q: Which one of the statements below best describes the mechanism of proton translocation by the…
A: The Q cycle (named after quinol) is a set of reactions. The Q cycle describes how the sequential…
Q: NADH is generated at which of the following enzyme site(s) in the citric acid cycle? OA) Aconitase.…
A: Citric acid cycle is the second step in aerobic cellular respiration. This stage results in the…
Q: Hydrolysis of dodecapeptide P with the enzyme trypsin affords the following fragments: Arg,…
A: Trypsin and chymotrypsin are the proteolytic enzymes that can cleave peptide bonds of proteins with…
Q: human cannot digest stachyose. Why？isn‘t it true that human do have aplpha galactosidase to break…
A: Some carbohydrates cannot be broken down in the small intestine by human enzymes. Raffinose and…
Q: 18. A biochemist has a 0.1000 L sample of a globin protein at a concentration of 0.0500 M. The P50…
A: Recall that: Fractional Saturation (θ) is the fraction of protein molecules saturated with a ligand.…
Q: Cystic fibrosis is a recessive disease that affects many parts of the body, but primarily presents…
A: The CFTR gene codes for the protein cystic fibrosis transmembrane conductance regulator (CFTR). The…
Q: Which of the following statements is TRUE concerning the synthesis of the leading and lagging…
A: DNA replication is a process by which one molecule of DNA is duplicated to 2 molecules of DNA. The…
Q: The drug below is used in the treatment of: O Rheumatoid arthritis. O Gram(+) bacterial infections.…
A: Heterocyclic ring is a ring structure made up of different atoms. Given to us a heterocyclic…
Q: 1 lactose is the digestive enzyme that breaks the dissaxhrode lactose into glucose and…
A: Enzymes are usually composed of proteins which catalyzes biochemical reactions by decreasing the…
Q: 1 starting with datp and dctp draw the synthesis of d(ac) dinucleotide. 2 draw the guanine…
A: "Since you have asked multiple questions, we will solve the first three questions for you. If you…
Q: One of the functions of the pentose phosphate pathway is to make NADPH, which plays important roles…
A: Nicotinamide adenine dinucleotide phosphate (NADP+) is used as a cofactor in anabolic reactions.…
Q: Coenzyme A is: A) a form of cellular energy. OB) an anabolic electron carrier. C) a catabolic…
A: Cells convert energy into small, energy-rich molecules such as ATP and nicotinamide adenine…
Q: The citric acid cycle is shown. The methyl carbon in acetyl CoA is labeled with C14C14 (shown in…
A: Carbon tracing is a biochemical technique of tracking the path taken by a specific carbon atom in a…
Q: Compare the molecular property of amino acids and their roles in protein folding.
A: There are 20 general proteogenic amino acids (amino acids that are often found in proteins). These…
Q: Which of the following statements is INCORRECT? OA) The inhibition of phosphofructokinase leads to…
A: In the process of glycolysis, the six-carbon sugar glucose is divided into two molecules of the…
Q: true or false: Guanylate phosphorylase is responsible for converting guanosine monophosphate into…
A: Nucleosides are pentose sugar linked to heterocyclic nitrogenous bases. Nucleotides are phosphoric…
Q: Which of the following statements is/are CORRECT? A) Phosphoenolpyruvate carboxykinase is inhibited…
A: Gluconeogenesis is the metabolic pathway in which Glucose is synthesized from non carbohydrate…
Q: True or False – During fermentation, pyruvic acid is reduced by FADH2 to free up FAD+ to keep…
A: Glycolysis is the collection of 10 enzymatically catalysed reactions that sequentially oxidises a 1…
Q: Draw structure Guanine and Adenine and describe the difference in the structure?
A: Nucleotides vs nucleosides Nucleosides are pentose sugar(ribose in the case of RNA and deoxyribose…
Q: Which of the following factors favor fatty acid synthesis in liver cells when blood glucose levels…
A: The body utilizes carbohydrates as the primary source of energy. The excess carbohydrates after…
Q: Which enzyme catalyzes the following reaction?
A: MM kinetics relates the initial rate of a reaction with initial substrate concentration when the…
Q: illustrate the nucleic acid metabolism to produce uric acid (please do it in a flowchart form,…
A: DNA/RNA are nucleic acids, the molecules responsible for carrying genetic information from one…
Q: Why is it critical that NAD* and FAD be regenerated inside the mitochondrial matrix rather than the…
A: NAD+ and FAD are coenzymes derived from vitamin B3 and vitamin B2 respectively. Both NAD+ and FAD…
Q: Structure and properties of triacylglycerols, their biological role.
A: Triacylglycerols, also known as triglycerides, are made up of three fatty acids that are…
Q: Part A Determine the amino acid sequence of a peptide section of beta-amyloid containing 10 amino…
A: Amino acid sequences are written with N-terminal amino acid on the left and C-terminal amino acid on…
Q: A characteristic of complex III is that it is reduced by FADH2. participates in electron transfer…
A: ETC consist of four protein complexes called Complex I, II, III and IV that transport electron…
Q: Name the following polypeptide: CH₂OH H H H₂N-C- H H CH₂ H CH3 H CH2 JI C-N-C-C-N-C-C-N-C-C-N-C-COO…
A: Polypeptide is a unbranched continuous chain of amino acids joined by peptide bonds. Peptide bond is…
Q: true or false: Ribonucleotide reductase reduces a NDP to a dNDP using electrons originating from…
A: Ribonucleotide reductase is an enzyme which is involved the catalysis of formation of…
Q: In animal tissues, the ratio of active, unphosphorylated to inactive, phosphorylated pyruvate…
A: Cellular respiration is a collection of three metabolic pathways that generate ATP the energy…
Q: Does the complete oxidation of tridecanoic acid (C13:0) make more ATP than the complete oxidation of…
A: Triacylglycerols are stored form of lipids in the body. When there is a lack of energy and…
Q: In an immunoassay, antibodies used to recognize and bind to antigens are called primary antibodies…
A: Immunoassays are used to detect the presence of an antigen (or even an antibody). Primary…
Q: For each of the metabolic transformations (a) through (d), determine whether the compound on the…
A: The biological oxidation-reduction (redox) reaction involves the transfer of electrons from one…
Q: e. Write the equations involved in the neutralization process of antacids. (Gastrointestinal Agents)
A: Antacids are medicines that are used to treat acidity. Antacids cure acidity by reacting with acids…
Q: BIOC 385 Biochemistry of Protein Synthesis Q11.4: Considering that binding of the correct tRNA to…
A: Translation is the process of protein synthesis. It occurs in the cytoplasm. Ribosomes have peptidyl…
Q: LDL is a metabolite of VLDL. Under normal physiological conditions, LDL that is internalized by a…
A: The low density lipoproteins that collect on the walls of blood vessels, raises the possibility of…
Q: Which of the following statements concerning insulin is NOT true? a. Insulin can increase glycogen…
A: Glycolysis is the metabolic process that breaks down glucose into pyruvate. Gluconeogenesis if the…
Q: Carnitine combines with fatty acids groups to form acyl carnitine through carnitines ____ group…
A: Beta-oxidation of fatty acids occurs in mitochondria. Before beta-oxidation starts each fatty acids…
Q: Hypo and hyperglycemia, causes and consequences
A: The major sugar present in the blood is known as blood sugar or glucose. It originates from the food…
Q: HOW MANY of the following five items represent modes of protein denaturation? 1.) heating a protein…
A: Proteins are biomolecules composed of amino acids. Amino acids are joined together through peptide…
Q: Which of the following is NOT a zymogen? A) Chymotrypsinogen. B) Proelastase. C) Enteropeptidase.…
A: Zymogens are inactive form of enzymes that upon successful cleavage and processing are converted to…
Q: 1) Define the following terms as they relate to protein synthesis (translation). A) initiation B)…
A: Since you have posted multiple questions, we will provide the solution only to the first question as…
Q: The phrases or terms describe different fundamental processes of nucleic acids. Classify each phrase…
A: Replication, transcription, translation are the three processes of central dogma of life.…
Step by step
Solved in 2 steps
- Replication of a circular DNA molecule can occur by either theta replication or by rolling circle replication. Describe or explain three differences between these two modes of DNA replication. Be VERY specific and accurately describe the differences between the two.In DNA replication, the fundamental reason that Okasaki fragments are produced is that Group of answer choices DNA replication can proceed only in the 5’ to 3’ direction replication on the leading strand is slower than replication on the lagging strand DNA polymerase tends to slip while replicating the lagging strand DNA polymerase has to alternate between the leading and lagging strands during replication none of these are true.During eukaryotic DNA replication, _________ synthesizes short RNA primers. The primers provide a 3'-OH group to which DNA nucleotides are be added by DNA polymerase. DNA gyrase (topoisomerase) DNA helicase DNA ligase primase
- Replication of a circular DNA molecule can occur by either theta () replication or by rolling circle replication. Describe or explain three differences between these two modes of DNA replication (you must accurately describe differences between the two approaches to replication - an accurate statement about one form of replication that does not clearly indicate how the other form differs is not a correct)Fill in the blank. As helicase unwinds closed circular DNA, it compensates for positive supercoiling. The stress of this force must be overcome or the replication machinery will be unable to proceed. DNA gyrase, a bacterial __________, is the leading candidate for this role in coli.At a growing replication fork, the replication of the two strands is: Question 15 options: continuous for the leading strand and discontinuous for the lagging strand. continuous for the lagging strand and discontinuous for the leading strand. uncoupled and independent of each other. discontinuous for both strands due to low processivity of the DNA polymerase.
- Shown below is a long template strand of DNA where lagging strand DNA synthesis is occurring. The short horizontal lines represent two Okazaki fragments that have already been made. In the context of the replication fork, select the letter(d–g) that indicates where primase will synthesize the next RNA primer. Explain why did you choose that location?DNA polymerase requires both a template, to be copied, and a primer, which provides a 3′ hydroxyl from which polymerase can extend. Yet, this molecule supports DNA polymerase activity. Explain. pTGACACAGGTTTAGCCCATCGATGGG -OHPolymerases work is to add 10 nucleotides to a DNA strand before dissociating. During replication process, DNA pol III can add tens of thousands of nucleotides at a moving fork. How this additionaccomplished?
- Polymerases usually add only about 10 nucleotides toa DNA strand before dissociating. However, during replication, DNA pol III can add tens of thousands ofnucleotides at a moving fork. How is this additionaccomplished?The reaction in DNA replication catalyzed by DNA ligase isa) Addition of new nucleotides to the leading strandb) Addition of new nucleotide to the lagging strandc) Formation of a phosphodiester bond between the 3’-OH of one Okazaki fragment and the 5’-phosphate of the next on the lagging strandd) Base pairing of the template and the newly formed DNA strandDNA pol III synthesizes the leading strand as a continuous strand. The lagging strands are synthesized in segments, called __________
