1) Define the following terms as they relate to protein synthesis (translation). A) initiation B) elongation C) termination
Q: In animal tissues, the ratio of active, unphosphorylated to inactive, phosphorylated pyruvate…
A: Cellular respiration is a collection of three metabolic pathways that generate ATP the energy…
Q: answer question 2 please asap
A: Polymerase chain reaction (PCR) can amplify a single target DNA fragment from a complex mixture of…
Q: The pancreas is an organ of mixed secretion. Endocrinely, beta-cells produce the hormone insulin,…
A: Hormones are signalling biomolecules that are released from endocrine cells into the bloodstream and…
Q: Given the following information about amino acid tyrosine answer questions 1 & 2: A. HO pka3 10.1…
A: Since you have posted multiple questions with multiple sub parts, we will provide the solution only…
Q: What do all fats have in common? A) they all have identical hydrocarbon chains B) they are acidic C)…
A: Lipids are a chemically diverse group of biomolecules that have two things in common: low…
Q: Discuss (as comprehensively but as concisely as possible) the role of protein folding in any (one)…
A: Since the question has mentioned to write about any one disease, I’ll write about (c) Cystic…
Q: Which of the following reactions does not occur mammals? O pyruvate + NADH-lactate + NAD+ O…
A: Pyruvate is the end product of glycolysis. In the presence of oxygen, it enters aerobic respiration,…
Q: Elaidic acid is an 18 carbon fatty acid with a trans double bond at carbon 9 that is produced in…
A: The major physical property of fatty acid is their melting point, which in-turn define at which…
Q: Classification of lipids.
A: A category of heterogeneous chemical substances that are soluble in non-polar solvents are referred…
Q: A patient on dapsone begin to experience dizziness and vertigo 3 days after taking his medication.…
A: Cyanotic defects: Cyanosis is a condition caused by cyanotic defects, in which the blood pumped to…
Q: Next exam will be on carbohydrates, protein equencing and enzymes iochemistry roblem Assignment…
A: Emil Fischer invented the Fischer projection, a method of representing the three-dimensional…
Q: Which of the following statements concerning D-glucose in INCORRECT? O a. It is a monosaccharide. O…
A: Carbohydrates or carbs are maconutrient consisting of Carbon, hydrogen and oxygen atoms. In nature…
Q: DNA polymerase I functions in DNA replication to: O a. O b. O C. synthesize the RNA primer…
A: The replication process is in which there is synthesis of DNA using DNA strand. There are various…
Q: What is the biochemical mechanism by which ingesting 2,4-dinitrophenol (DNP) results in rapid weight…
A: 2,4 DNP is an uncoupler of electron transport chain that is used primarily for weight loss. 2,4 DNP…
Q: Draw structure of Cytosine, Thymine and Uracil and describe the difference in the structure?
A: Nucleotides vs nucleosides Nucleosides are pentose sugar(ribose in the case of RNA and deoxyribose…
Q: How many calories are in 7101 J? (1 cal = 4.184 J)
A: Calories and joules are the units of energy . Energy is required by the body to perform functions.…
Q: LO43 Identify the levels at which gene expression can be regulated in prokaryotes and eukaryotes…
A: Gene regulation is the process of control of expression genes. This process occurs by several…
Q: For each pair of biomolecules, identify the type of reaction (oxidation‑reduction, hydrolysis,…
A: Enzymes are proteins that act as biocatalysts. Enzymes are classified into six classes based on the…
Q: Palmitate is a 16-carbon fatty acid. After complete B-oxidation of one molecule of palmitate, how…
A: Beta oxidation is the oxidation or catabolism of fatty acids that take place in mitochondria. Two…
Q: Match the protein subunit with the correct functional component of the yeast ATP synthase complex in…
A: ATP synthase has two parts-Fo and F1. The Fo is bound to inner mitochondrial membrane whereas the F1…
Q: In hepatocytes, the enzyme glucokinase catalyzes the ATP-coupled phosphorylation of glucose.…
A: In the reaction mechanism catalysed by glucokinase, glucokinase binds and brings ATP and glucose…
Q: Macmillan Learning All the dehydrogenases of glycolysis and the citric acid cycle use NAD+ (E'° for…
A: The value of free energy change helps to determine the spontaneity of a reaction. A positive ∆G…
Q: At pH 7, the most predominant interaction between glucuronic acid (structure seen below) and the…
A: Electrostatic interactions are the interactions that might be attractive or repulsive that form…
Q: 3.5 An a helical, intracellular protein, ITSME, denatures at 80 degrees Celsius. Which of the…
A: Proteins are polymers of amino acid residues linked together via a peptide bond. The amino acid…
Q: Why does glutamate the only amino acid used in oxidative deamination
A: Glutamate is an acidic amino acid that acts as the only amino acid used in oxidative deamination.…
Q: How many mL of 19 mM SDS would you need to make 76 mL of 2 mM SDS? Report your answer rounded to 1…
A: Molarity is a way of representing the concentration of a solution. Molarity is the number of moles…
Q: In addition to the oxidation of cytochrome c by Comple transport systems, what other reaction is…
A: Introduction The electron transport chain (ETC) is the last part of aerobic respiration. An electron…
Q: For each pair of biomolecules, identify the type of reaction (oxidation‑reduction, hydrolysis,…
A: A dipeptide is a two amino acid linked via a peptide bond. The peptide bond is formed between the…
Q: In one form of thalassemia, the mutation of a single base from G to A generates a new 3' splice site…
A: As per the central dogma of molecular biology, genetic information is stored in the DNA. The genetic…
Q: Arrange the following in the order they appear in electron transport. a. FAD, coenzyme Q, cytochrome…
A: Electron transport chain is a chain of electron carriers present in the inner mitochondrial…
Q: The total degradation of a fatty acid with an odd number of carbons yields acetyl-CoA and another…
A: Fatty acids are carboxylic acids with a hydrocarbon chain ranging from 4 carbon to 36 carbons.…
Q: How do ATP levels regulate glycolysis? 00 High levels of ATP enhance glycolysis ATP levels do not…
A: Cellular respiration is the process how biochemical energy is generated from food. It involves the…
Q: true or false: Ribonucleotide reductase reduces a NDP to a dNDP using electrons originating from…
A: Ribonucleotide reductase is an enzyme which is involved the catalysis of formation of…
Q: Which of the following statements is TRUE concerning the synthesis of the leading and lagging…
A: DNA replication is a process by which one molecule of DNA is duplicated to 2 molecules of DNA. The…
Q: Please explain the formula (process) used to get the Red undelived numbers, Thanks!! example each…
A: Enzyme kinetics - Enzymes are usually comprise of protein molecules which is used to catalyzed…
Q: What is the committed step of pyrimidine biosynthesis? Include the names and structures of any…
A: Pyrimidines are nitrogenous bases found in nucleic acids. Pyrimidines are heterocyclic organic…
Q: could you please write the equation on paper with pen? I cannot understand the equation clearly.
A: The competitive inhibitors are the molecules which inhibits the enzyme catalyzed reaction by binding…
Q: Make a summary
A: Glucagon is a peptide hormone secreted by the pancreas in response to low blood glucose levels.…
Q: AG" for reaction A B = -10 kJ/mol AG" for reaction BC = -8 kJ/mol AG" for reaction CD = 5 kJ/mol AG"…
A: The standard free energy change (∆G°) of a chemical reaction is the free energy change at the…
Q: Glucagon is a hormone that indicates low blood glucose. A. Where is glucagon generated and released…
A: Carbohydrates that are obtained through the diet are digested into monosaccharides such as glucose…
Q: Describe the mechanism for moving acetyl-CoA produced in the mitochondrial matrix into the cytosol…
A: An enzyme called acetyl CoA carboxylase in the cytoplasm catalyzes the carboxylation of Acetyl CoA…
Q: Draw the complete electron pushing mechanism for the reaction.
A: Oxidation of glucose into pyruvate followed by oxidation of pyruvate into acetyl CoA and then…
Q: Structure and formation reactions of phosphatidylcholine, phosphatidylethanolamine,…
A: Let us understand how phospholipids themselves are synthesized, then we understand how slight…
Q: Denatured protein is in a low energy state. What sort of explanation can you use to rationalize that…
A: Denaturation of protein: When proteins are denaturized, they lose the quaternary, tertiary, and…
Q: true or false: Aspartate trans-carbamoylase is inhitibited by ATP, an example of feedback…
A: Aspartate transcarbamoylase or ATCase is an allosteric enzyme that catalyses the first step of…
Q: Compare and contrast glycerophospholipids and triacylglycerols(functions, structure), including…
A: Lipids are a chemically diverse group of biomolecules that have two things in common: low…
Q: Which of the following statements about gluconeogenesis is TRUE? Gluconeogenesis is one way to…
A: The term "gluconeogenesis" describes a collection of metabolic processes that take place in the…
Q: Given a peptide chain that is composed of the following amino acids: (branched chain-- polar…
A: Chromatography is a separation technique by which amino acids dissolved in a mobile phase are…
Q: If the following oligosaccharide was treated with an enzyme that cleaved only a1,4 glycosidic bonds,…
A: Chemically carbohydrates are polyhydroxy aldehydes or ketones. They have the general formula :…
Q: ½ O₂ + 2H+ +2 e → H₂O FAD + 2H+ + 2e → FADH₂ E'º = 0.816V E'º = -0.219V Calculate the AG" of the…
A: Biological oxidation-reduction reactions involve the transfer of electrons from one biomolecule,…
Step by step
Solved in 2 steps
- What is an Okazaki fragment, and how are they later “glued” together? What are the types and major functions for each type of RNA? Define transcription and translation. Which process occurs first to make protein from DNA? In what direction does a polymerase move when synthesizing a strand of mRNA? What mRNA sequence is synthesized from a section of DNA that is 3’-TTGACCT-5’?The template strand of a double helical segment of DNA consists of the following sequence: 5’-GTAGCCTTAAGCGATCACCGTCCGTATTACTAGTGGCCAGACTCTTTTCACTCTCATGTATAGTTG-3’ Following translation process, what is the amino acid sequence that will be coded for? (show your answer using THREE-letter amino acid code starting from N-terminus to C-terminus)The template strand of a double helical segment of DNA consists of the following sequence: 5’-GTAGCCTTAAGCGATCACCGTCCGTATTACTAGTGGCCAGACTCTTTTCACTCTCATGTATAGTTG-3’ What is the nucleotide order in the complementary mRNA that can be transcribed from the given DNA strand?
- The template strand of a double helical segment of DNA consists of the following sequence: 5’-GTAGCCTTAAGCGATCACCGTCCGTATTACTAGTGGCCAGACTCTTTTCACTCTCATGTATAGTTG-3’ Following translation process, what is the amino acid sequence that will be coded for? (show your answer using ONE-letter amino acid code starting from N-terminus to C-terminus)What are the components of the initiation complex in protein synthesis? How do they interact with one another?The process of translation involves three distinct phases: initiation, elongation, and termination. Which of the following is an accurate statement of a molecular event that occurs during one of the phases? A. All phases of translation require the energy of ATP to fuel molecular processes. B. The first components to assemble in initiation are the large ribosomal subunit, mRNA, and the initiator tRNA molecule. C. A peptide bond forms between the new amino acid and the amino acid at the C-terminus of the growing polypeptide chain. D. Amino acids are added to the polypeptide chain that sits in the A site of the translation initiation complex.
- Translate the following mRNA nucleotide sequence into an amino acid sequence, starting at the first base: 5’ - UGUCAUGCUCGUCUUGAAUCUUGUGAUGCUCGUUGGAUUAAUUGU - 3’Use the following DNA sequence, and write the resulting messenger RNA sequence TACTTTGAATGCGGCCGTATC?Consider the following DNA template: 5’-AAGAGGTTCCAATGCAGGCACTCACCAACTCTTAAATAAA-3’ 3’-TTCTCCAAGGTTACGTCCGTGAGTGGTTGAGAATTTATTT-5’ If the bottom DNA strand is used as template to transcribe mRNA, predict the amino acid sequence that would result from the process of translation. Met-Ala-Leu-Thr-Gln-Glu-Gly Met-Gly-Ser-Leu-Asn-Ser-Gln Met-Thr-Asn-Ser-Leu-Ala-Gln Met-Gln-Ala-Leu-Thr-Asn-Ser Met-Glu-Ala-His-Trp-Ser-Tyr
- Given the following stretch of mRNA, what would be the sequence of the corresponding non-template DNA? 5' - UUG-CAA-UCG-CAG-UGC-CGC-AUA-GAU - 3' Group of answer choices 3' - AAC-GTT-AGC-GTC-ACG-GCG-TAT-CTA - 5' 5' - TTG-CAA-TCG-CAG-TGC-CGC-ATA-GAT - 3' 5' - AAC-GTT-AGC-GTC-ACG-GCG-TAT-CTA - 3' 3' - AAC-GUU-AGC-GUC-ACG-GCG-UAU-CUA - 5' 3' - TTG-CAA-TCG-CAG-TGC-CGC-ATA-GAT - 5'What are two major similarities between protein synthesis in bacteria and in eukaryotes? What are two major differences?Given the template DNA sequence: 3’ - TAC - CAG - GTT - ACC - ATC - 5’ A.) What will be the mRNA requence corresponding to the template DNA sequence? B.) What is the amino acid sequence in letter A? ( e.g. Arg, Phe, etc.) C.) If the coding sequence of the dsDNA will "serve" as the template for transcription, what is the corresponding mRNA sequence? D.) With the mRNA transcript in letter C, what will be the amino acid sequence? ( e.g. Arg, Phe, etc.)