Each DNA sequence that can serve as an origin of replication is found to contain a binding site for a large, multi-subunit initiator protein called ORC; a stretch of DNA rich in C/G nucleotides and therefore easy to unwind; and at least one binding site for proteins that help attract ORC to the origin DNA. Group of answer choices True False

Each DNA sequence that can serve as an origin of replication is found to contain a binding site for a large, multi-subunit initiator protein called ORC; a stretch of DNA rich in C/G nucleotides and therefore easy to unwind; and at least one binding site for proteins that help attract ORC to the origin DNA. Group of answer choices True False

Human Heredity: Principles and Issues (MindTap Course List)

11th Edition

ISBN:9781305251052

Author:Michael Cummings

Publisher:Michael Cummings

Chapter8: The Structure, Replication, And Chromosomal Organization Of Dna

Section: Chapter Questions

Problem 13QP

See similar textbooks

Similar questions

Single-stranded binding proteins (SSBPs) bind to single-stranded DNA at the replication fork and prevent formation of short hairpin sequences that would otherwise impede DNA synthesis. What sorts of sequences in single-stranded DNA might be able to form a hairpin? Write out an example of a sequence that could form a 5-nucleotide hairpin loop, and draw it.
he bases of one of the strands of DNA in a regionwhere DNA replication begins are shown at the endof this problem. What is the sequence of the primerthat is synthesized complementary to the bases inbold? (Indicate the 5′ and 3′ ends of the sequence.)5′ AGGCCTCGAATTCGTATAGCTTTCAGAAA 3′
Spontaneous deamination of cytosine bases in DNA takes place at low but measurable frequency. Cytosine is converted into uracil by loss of its amino group. After this conversion, which base pair occupies this position in each of the daughter strands resulting from one round of replication? Two rounds of replication? (a) How many different 8-mer sequences of DNA are there? (Hint: There are 16 possible dinucleotides and 64 possible trinucleotides.) We can quantify the information- carrying capacity of nucleic acids in the following way. Each position can be one of four bases, corresponding to two bits of information (2² = 4). Thus, a chain of 5100 nucleotides corresponds to 2 × 5100 = 10,200 bits, or 1275 bytes (1 byte =8 bits). (b) How many bits of information are stored in an 8-mer DNA sequence? In the E. coli genome? In the human genome? (c) Compare each of these values with the amount of information that can be stored on a computer compact disc, or CD (about 700 megabytes).
The purpose of DNA gyrase in replication is: to relieve positive supercoiling induced by unwinding the DNA during replication. to induce tighter coiling in supercoils. to remove the RNA primers from the lagging strand at each Okazaki fragment to start unwinding and separate the DNA to initiate replication to provide energy to remove a diphosphate fragment from each nucleoside triphosphate.
The compound known as nitrous acid is a reactive chemical that replaces amino groups (NH2) with keto groups (=O). When nitrous acid reacts with the bases in DNA, it can change cytosine to uracil and change adenine to hypoxanthine. A DNA double helix has the following sequence: AACCTACGACC TTGGATGCTGG A. What would be the sequence of this double helix immediately after reaction with the nitrous acid (i.e. before replication)? Let the letter H represent hypoxanthine and U represent uracil. B. Following exposure the nitrous acid was removed, and the DNA was replicated for one generation. What would be the sequence of the DNA products after the DNA sequence resulting from treatment in Part A had replicated once? Your answer should contain the sequences of two double stranded DNA molecules. Note: During DNA replication, uracil hydrogen bonds with adenine, and hypoxanthine hydrogen bonds with cytosine.
The DNA STRAND IS 3’ TAC-AGC-ACT-CAG-TCA 5’, and Non-template strand = 5' - ATGTCGTGAGTCAGT - 3' . If on the non-coding strand of DNA there is suddenly one T base that sneaks into the 4th sequence (from the left), or causes a mutation, then how will the RNA be formed and the chain arrangement of the amino acids produced by this mutation?
Select the false statement. The canonical B-DNA structure Is formed by G-T and A-C nucleotide pairs. Dissociates into single strands at a melting temperature. Features parallel stacks of nucleobase pairs. Features a minor grove that is deeper and wider than that in an A form. Requires about 10 nucleotides for a complete helical turn.
During DNA replication, the function of RNA primers is to Group of answer choices serve as a binding site for DNA ligase separate the two strands of the double helix to open replication "bubbles" serve as starting points for DNA strand elongation by DNA polymerase in the 3' - 5' direction prevent new-separated strands of DNA from rejoining serve as starting points for DNA strand elongation in the 5' - 3' direction by DNA polymerase
Deamination of adenine results in the formation of hypoxanthine. Hypoxanthine selectively base pairs with cytosine. If this error is not corrected, what base pair can the original A·T base pair be converted to after cycles of DNA replication?a) G·C b) C·G c) T·A d) A·G
Describe the d=features of the following DNA-binding domains and how they interact with DNA. Helix-turn-Helix Zinc Finger Leucine Zipper Helix-loop-Helix
Assume that the sequence of bases shown below is presenton onenucleotide chain of a DNA duplex and that the chain has openedup at a replication fork. Synthesis of an RNA primer occurs on thistemplate starting at the base that is underlined.(a) If the RNA primer consists of eight nucleotides, what is itsbase sequence?(b) In the intact RNA primer, which nucleotide has a free 3'-OHterminus?3'.......GGCTACCTGGATTCA....5'
DNA polymerase occasionally incorporates the wrong nucleotide during DNA replication. If left unrepaired, the base-pair mismatch that results will lead to mutation in the next replication. As part of a template strand, the incorporated wrong base will direct the incorporation of a base complementary to itself, so the bases on both strands of the DNA at that position will now be different from what they were before the mismatch event. The MER-minus strain of yeast does not have a functional mismatch excision repair system, but it has normal base excision repair and nucleotide excision repair systems. Which of the following statements is correct about differences in the mutation spectrum between MER-minus and wildtype yeast? More than one answer is correct. Options: More point mutations will arise in MER-minus yeast. Fewer point mutations will arise in MER-minus yeast as compared with wildtype. Of the total point mutations that…