Q: A clade is_____ . a. defined by a derived character c. a hypothesis b. a monophyletic group d. all o...
A: A clade is a group, consisting of an common ancestor and all its descendants, a single "branch" on t...
Q: In pygmy grasshoppers individuals are highly variable in coloration. They live on gravel at the edg...
A: One of the key mechanisms driving evolution is what's known as natural selection. This is the proces...
Q: 40. The process of removal of redundant synapses that results in a streamlined process of rapid cogn...
A: Synapse: A synapse is a structure in the nervous system that allows a neuron (or nerve cell) to sen...
Q: QUESTION 1 Match each structure with its function * Epididymis A. Structures that make seminal fluid...
A: Introduction: The main reproductive organs of the male body are the testes, which produce sperm and ...
Q: QUESTION 30 Which of the following is characteristic of the events at the inhibitory synapse? O Syna...
A: The term inhibitory synapse is associated with particular sort of junction in which activation from ...
Q: Chose the incorrect statement from below. Select one: O a. Protein stability and subsequently benton...
A: with increasing alcohol content, protein stability does not increase.
Q: Search the NCBI protein database using the EC number, limit your search to Mycobacterium tuberculosi...
A: We know about protein data base as we get the information of nucleic acid sequence or protein sequen...
Q: What is the allele frequency of the a allele in a population with 15 AA homozygotes, 10 heterozygote...
A: There are certain formulas that can be used to find the genotypic and allelic frequencies of differe...
Q: If a component is heat sensitive, how might you conveniently achieve sterility of that medium? a. f...
A: Sterilization is a process where a medium suppose milk heated in high temperature (above 100° celciu...
Q: Question:- 1. Brassica oleracea is the wild plant from which brussels sprouts, cabbage, broccoli, a...
A: Brassica oleracea is a wild plant species that are modified through artificial selection to produce ...
Q: Which of the following is NOT an evidence for Darwin's theory of common descent? Group of answer cho...
A: Darwin's theory of common descent is idea that defines species change overtime giving rise to new sp...
Q: In imaginary (thank goodness) forced feeding experiments, some very unethical scientists determine t...
A: LD50 or lethal dose 50 is the amount of a substance that is needed to kill half of the test populat...
Q: Monkeys and apes are odd when compared to other mammals because they lack the ability to produce vit...
A: L-ascorbic acid or Vitamin C , is a water-solvent nutrient that is normally present in certain food ...
Q: of eukaryotic cellular processes llowing processes take place. Bl
A:
Q: Describe the reaction oh Hatch-Slack (enzyme names are not required). While doing so make sure to su...
A: C4 Pathway It was Hatch and Slack , who discovered the C4 pathway in 1966. Plants that are adapted t...
Q: (a) Name the following : (i) The phenomenon by which living or dead plant cells absorb water by surf...
A: A cell is the smallest unit of life. It is divided into two types: prokaryotic and eukaryotic. A cel...
Q: A toxin with a higher LD50 value is more deadly than a toxin with a lower LD50 value, assuming a per...
A: LD50 value Median lethal dose is a measure of lethal dose of a toxic chemical.
Q: 2. Describe how pigments work as it relates to photosynthesis. Make sure you note what part of the p...
A: Photosynthesis is the process of carbon fixation in plants. This uses sunlight as the source of ener...
Q: What is the importance of preparing direct fecal smear for examination? What are the characteristics...
A: The direct faecal smear technique is the simplest and most efficient method for detecting intestinal...
Q: All of the following data types can be used as evidence of shared ancestry except similarities in___...
A: Many scientists have discovered the existence of a common ancestor using clear evidence from their r...
Q: In growing E.coli, why is that (reasons) they do not grow after doubling time under 20 degrees celsi...
A: In a core typical range of its growth temperatures (20 to 37°C), Escherichia coli cells will grow ev...
Q: In a series of infection experiments, a researcher discovers that the ID50 value for the infectious ...
A: Answer Parasiticum mucoides
Q: TRNA has peptidal transferase activity. 1 point True False Genetic information stored in mRNA 1 poin...
A: Q. tRNA has peptidal transferase activity. True False Q.Genetic information stored in mRNA is tran...
Q: Paleontologists at Grand Staircase-Escalante National Monument discovered a new ceratopsid skull. Th...
A: Introduction :- A palaeontologist is a scientist who analyses the fossil record to learn about the e...
Q: Translocations occurs between A) homologous chromosomes B) Nonhomologous chromosomes C) homologous c...
A: The migration of chromosomal sections among chromosomes is known as interchromosomal translocation. ...
Q: Saved Review the relationships between blood flow, flow velocity, total cross-sectional area, pressu...
A: Lesser than: Blood flow through the aorta is lesser than blood flow through the capillaries. Blood ...
Q: Scientists are examining the possible role of a large asteroid in the Cretaceous mass extinction eve...
A: ANSWER;- OPTION C is correct ( after the asteroid strike).
Q: A strain with the ability to conjugate is mixed with a recipient strain. Recipients are noted to be...
A: Bacterial conjugation can be described as a means of bacterial horizontal gene transfer. It can also...
Q: TRNA has peptidal transferase activity. True False Genetic information stored in mRNA is translated ...
A: A ribosome is a biological unit made up of Protein molecules and RNA that functions as the cell's pr...
Q: Assume that humans are the second-level carnivores and that each energy unit in their level represen...
A: There are 7 question in total, according to our guideline i will gave you 3 answer. If you want to a...
Q: ______ is a way of reconstructing evolutionary history based on derived characters. a. Cladistics c....
A: Cladistics is a way of reconstructing evolutionary history based on derived characters. Cladistics h...
Q: In a Eukaryotic cell, Transcription occurs in the _____________________ of a cell while Translation ...
A: Answer - a. In a Eukaryotic cell, Transcription occurs in the nucleus of a cell while Translation oc...
Q: In cacti, the leaves are reduced into spines. Give some reasons why the cacti underwent such modific...
A: Leaves of cactus plant are modified into spines. Spines play an important role for plants situated i...
Q: You are studying Protein X which plays a role in promoting the G1/S phase transition in eukaryotic c...
A: G1/S phase transition is cell cycle stage between G1 phase and S phase. This transition phase ensur...
Q: Aortic valve closure AV valve opening Systolic pressure Isovolumetric relaxation Isovolumetric contr...
A: The stages involved in converting deoxygenated blood to oxygenated blood in the lungs and propelling...
Q: Why is it important to determine the blood types of the donor and the recipient in transfusions?
A: Introduction In this question we will discuss why it is important to determine the blood types of th...
Q: Use examples to explain the difference between analogousstructures and homologous structures.
A: Evolution is defined as the process by which opportunities arise within an individual over a period ...
Q: Please provide the illustration of the different stages of mitosis in Animal Cell Interphase, Early...
A: Mitosis : it's the equational division in which a diploid cell divides into two daughter cells havin...
Q: What is the most commonly used restrictive bariatric procedure worldwide?
A: Bariatric surgery basically deals with the treatment of obesity and is considered an option while ch...
Q: Identify the best taxonomic category that best describes the prokaryote in the given scenario. An is...
A: Prokaryotes and Eukaryotes: Living organisms are classified into prokaryotes and eukaryotes based on...
Q: Make a diagram showing the application of recombinant dna in the field of agriculture, medicine and ...
A: Recombination DNA technology has done Marvels in every field it uses vectors to transfer genetic com...
Q: SPECIMEN BASE TIP OUTLINE MARGIN VENATION LEAF SURFACE Allium cepa . Musa sp ...
A: Venation It is defined as the process of the formation of veins on the leaf. The two types of venati...
Q: A nonsense mutation (a) causes one amino acid to be substituted for another in a polypeptide chain (...
A: A nonsense mutation is defined as the process of the substitution of only a single base pair. This l...
Q: analyze the muscles acting and rising/standing phase of the squat. Please also identify if these mus...
A: During squatting, our muscles work in two different phases: 1. concentric phase where the muscles s...
Q: Identify the Genus of this organism.
A: Genus is Rhizopus.
Q: The only taxon that is always the same as a clade is the____ . a. genus c. species b. family d. king...
A: The only taxon that is always the same as a clade is the is Species.
Q: How might an evolutionary biologist explain why a species of salamander becomes blind after colonizi...
A: Evolution is described as a change in the allele frequencies, or genetic makeup, of a population or ...
Q: n Prophase II of melosis? OOOO
A: Introduction:- Meiosis is a process in which a single cell divides twice to produce four cells with ...
Q: Cancer is a disease that results in uncontrolled cell division. Cancer cells have lost their ability...
A: Cancer cells have mutations that inhibit apoptosis and increase cell division to a significant degre...
Q: Question 3 What type of selection occurs when one extreme population phenotype is favored? stabilizi...
A: Natural selection is defined as a process or force that allows organisms to better survive and produ...
Trending now
This is a popular solution!
Step by step
Solved in 2 steps
- Unlike eukaryotic cells, prokaryotic cells ________. a. have no plasma membrane b. have RNA but not DNA c. have no nucleus d. a and cWhich of the following is found both in eukaryotic and prokaryotic cells? a. nucleus b. mitochondrion c. vacuole d. ribosomecreate a venn diagram that lists (use point form) the differences between prokaryotic and eukaryotic cells and overlapping similarities.
- Which of the following structures could be foundwithin the nucleolus?a. chromatinb. histonesc. ribosomesd. nucleosomesPut the following cell structures in order from smallest to largest: nucleus, gene, chro-mosomeDefine the following terms:a. nucleoplasmb. chromatin fiberc. nuclear matrixd. nucleoluse. nuclear envelope
- . Which of the following characteristics of chloroplastsand/or mitochondria make them seem more similar tobacterial cells than to eukaryotic cells?a. Translation is sensitive to chloramphenicol anderythromycin.b. Alternate codons are used in mitochondria genes.c. Introns are present in organelle genes.d. DNA in organelles is not arranged innucleosomes.. The DNA of a bacteria is contained where in the cell?a. in the nucleusb. in a region of the cytoplasm called the nucleoidc. at the ribosomesd. within the lipopolysaccharide layerSince DNA is a hydrophillicmoelcule, it cannot pass through cell membranes. Name and explain the technique with which the DNA is forced into (ii) a bacterial cell (ii) a plant cell (iii) an animal cell.
- Indicate whether the following structures occur in Bacteria, Eukarya or both. Also indicate one function for the structure. 1 ) Ribosomes2) Nucleus3) Cell wall4) Flagella5) FimbriaeArrange the following cell ultrastructures in the order by which they will pellet out from a series of differential centrifugation steps: ribosome nucleus DNA endoplasmic reticulum mitochondriaIt is S phase of the cell cycle, and time to replicate the cell’s DNA. Using the following strand of DNA as a template, create the complementary strand: GCTCCTTACGGGCCCAATGACCTGAATGTACGAGATCCCATCCTT It is now time to make a protein. Using the same stand of DNA, transcribe it to mRNA, then translate to an amino acid sequence (use the codon table below).