Eukaryotic elongation factor 2 is inhibited by ADP ribosylation catalyzed by diphtheria toxin. What other G proteins are sensitive to this mode of inhibition?
Q: Ethylhydroceuprin (optochin) is a specific inhibitor of S. pneumoniae and its mechanism is: a.…
A:
Q: peptide bond formation is catalizyed at the larger ribosomal subunit. does this happend in…
A: Translation includes three phases: initiation, elongation, and termination. Initiation is a phase in…
Q: The genes that encode the enzymes for arginine biosynthesis are located at several positions around…
A: A gene is a stretch of nucleotides present on a chromosome. It is the region that encodes the…
Q: A mutated TBP protein Explain: (a) What is the process affected? (b) What is the Effect on the…
A: TATA-Binding protein or TBP attaches specifically to particular sequence of DNA called TATA box.…
Q: Why is Molisch's test used for the determination of the presence of pentose in the yeast RNA…
A: Carbohydrates are the polyhydroxy ketones or polyhydroxy aldehydes or their derivatives. In…
Q: Explain why (a) inactivation of the O2 or O3 sequence of the lac operon causes only a twofold loss…
A: An operon is defined as a group of genes that have a common promoter and regulator and also…
Q: A mutation occurred on the lacI (repressor) gene resulting in a constant production of…
A: Genes are the functional segments of DNA. The cluster of these functional segments called genes is…
Q: What is the best inhibitor of endoplasmic reticulum stress in human ?
A: Endoplasmic stress occurs when the capacity of the ER to fold proteins becomes saturated. There are…
Q: Ribosomes markedly accelerate thehydrolysis of GTP bound to the complex of EF-Tu and aminoacyltRNA.…
A: Introduction GTPases are regulatory molecular switches in various cellular machinery involving a…
Q: The codon change (Gly-12 to Val-12) in human rasH that convertsit to oncogenic rasH has been…
A: The codons are the triplet sequences of the nucleotides like DNA (deoxyribonucleic acid) and RNA…
Q: Members of the integrin family are the major cell surface receptors for many ECM proteins such as…
A: Integrins are a family of αβ heterodimers. Integrins are cellular adhesion receptor molecules that…
Q: Azidothymidine is a Thymidine analog used to inhibit viral reverse transcriptase. Explain the…
A: AZT is a structural analogue of the deoxy thymidine. it was first synthesized in 1964. it failed as…
Q: Based on the following wild type sequence, indicate if each of the mutations should be classified as…
A: Mutations are changes in the sequence of DNA which may or may not affect the phenotype of the…
Q: When the amino acid levels in eukaryotic cells are low, general protein synthesis is reduced.Gcn4…
A: Translation is a process in which a single stranded RNA sequence formed at the end of transcription…
Q: A mutant has no activity for the enzyme isocitrate lyase.Does this result prove that the mutation is…
A: Isocitrate lyase is an enzyme in the glycoxylate cycle that catalyzes the cleavage of isocitrate to…
Q: В C as1 wild type as1 mutant as1 superimposed A
A: Alpha-helices and beta-sheets are called the secondary structures of the protein. Secondary…
Q: Explain why mutations of the Arg residue in Gsα that is ADPribosylated by cholera toxin are…
A: A potential virulence factor developed by Vibrio cholerae, which is the causative factor of cholera…
Q: CTP synthetase is allosterically activated by GTP. What function might this play in the cell?
A: CTP synthetase is an enzyme which converts UTP ( Uridine Triphosphate) to CTP ( Cytidine…
Q: The peptide hormone glucagon tends to elevated in between meals. Among the effects that glucagon has…
A: Eukaryotic elongation Factor 2 (eEF2) mediates translocation of peptidyl-tRNA from A-site to P site…
Q: Why are cytosolic hsp70 chaperone proteins required for import of proteins into mitochondria and…
A: Hsp70 is a stress-induced protein needed for the health of the cell. High levels can be delivered by…
Q: The BSA precursor protein is 607 amino acids long and has a molecular weight 69.324 kDa. If a…
A: BSA is globular proteins. 1kDa = 1.66 * 10-21 gm The molecular weight of BSA precursor protein is…
Q: Contrast the functions of Spo11 and Cas9, twoenzymes that catalyze the formation of doublestrand…
A: The protein spo11 and cas9 plays a crucial role to initiate the recombination process in yeast and…
Q: The post transcriptional modifications of the mature prokaryotic messenger RNA are essential in…
A: Transcription is a heterocatalytic action of DNA by means of which RNA is synthesized from specific…
Q: When cladosporin acts as an antibiotic working in a bacterial cell, explain the mechanism of action…
A: Cladosporin is a tricyclic octaketide that's a secondary metabolite produced by several fungal…
Q: Eukaryotes modify mRNA with an m7G cap: an N7-methylated guanosine linked via a 5′ to 5′…
A: Post transcriptional capping refers to the attachment of an enzymatically appended cap on the 5'…
Q: Ribosomes markedly accelerate the hydrolysis of GTP bound to the complex of EF-Tu and aminoacyltRNA.…
A: GTPases are the large family of hydrolase enzymes that bind to the GTP and hydrolyze it to GDP. The…
Q: Hemophilia in the Russian royal family was caused by defective protein involved in blood clotting…
A: Nonsense mutations occur when a premature nonsense or stop codon is introduced in the DNA sequence.…
Q: what state will the prokaryotic repressor protein take in the place of lactose
A: Lac operon is the segment of DNA which contains regulatory gene, structural gene, promoter and…
Q: Susceptibility to developing prion diseases arises from a mutation that changes aspartic acid (Asp)…
A: Fatal familial insomnia (FFI) is caused due to the replacement of aspartic acid by asparagine in the…
Q: An individual carries a somatic mutation that changes a lysinecodon into a glutamic acid codon.…
A: A mutation is an alteration or change in a deoxyribonucleic acid (DNA) sequence. Mutations can…
Q: Sec61 is a protein involved in the formation of the translocon for ER-targeted proteins.What would…
A: Endomembrane system: - it is a system through which the cell modifies, packages and transports the…
Q: Please select all answers that are TRUE about post translational modification of proteases including…
A: Introduction: Those enzymes that break down the proteins into smaller molecules are proteolytic…
Q: Eukaryotes modify mRNA with an m7G cap: an N7-methylated guanosine linked via a 5′ to 5′…
A: Post transcriptional modification in Eukaryotic mRNA occurs by its enzymatic caping. The capping of…
Q: What aminos acid would the anticodon GAC be translated into?
A: * DNA will have four nucleotides Adenine Guanine Cytosine Thymine * RNA will have four…
Q: Which of the followings is/are regulated by proteolytic cleavage?
A: Proteolytic cleavage is the process through which proteolytic activation of an enzyme occurs. The…
Q: How does the loss of the Adenomatous polyposis coli (APC) protein lead to the deregulation of…
A: Answer: Introduction: Familial adenomatous polyposis (FAP) is an inherited syndrome categorized by…
Q: A drug called garcinol, isolated from Garcinia indica (a fruitbearing tree commonly known as kokum),…
A: Garcinol is a polyisoprenylated benzophenone derivative. It contains phenolic hydroxyl groups as…
Q: If the lacl gene is mutated so that the repressor protein no longer binds to lactose, what will be…
A: Step 1 - when lacI gene is mutated then the repessor protein can not bind to lactose . In this there…
Q: Consider the now dominant variant of the SARS-CoV-2 called the D614G mutation: a) The mutation…
A: mRNA is translated to form protein. mRNAs contain trinucleotides sequences that code for particular…
Q: In the: Mutation of the 28S RNA preventing the binding of the 40S with 60S ribosomes Explain: (a)…
A: Gene is the sequence of nucleotides that encode a protein.
Q: Explain why inactivation of the O1 sequence of the lac operator almost completely abolishes…
A: Lac operon of the bacteria includes the structural genes that code for the enzymes involved in the…
Q: Repressors are inactivated either by interaction with a small-molecule inducer or by proteolytic…
A: Lac Operon operates in bacteria. It allows the expression of proteins responsible for the catabolism…
Q: Hemophilia in the royal family was caused by the presence of a mutation in the gene for factor IX…
A: Inheritance or heredity is passing-on one trait form the parents to the progeny by either asexual or…
Eukaryotic elongation factor 2 is inhibited by ADP ribosylation catalyzed by diphtheria toxin. What other G proteins are sensitive to this mode of inhibition?
Step by step
Solved in 3 steps
- Which of the proteins: the CAP or the lac repressor, does the eukaryotic nuclear receptor for the glucocorticoid dexamethasone primarily resemble?A shortened version (apo B-48) of apolipoprotein B is formed by the intestine, whereas the fulllength protein (apo B-100) is synthesized by the liver. A glutamine codon (CAA) is changed into a stop codon. Propose a simple mechanism for this change.What is diauxic growth? Explain how catabolite repression causes diauxic growth.
- Ribosomes markedly accelerate the hydrolysis of GTP bound to the complex of EF-Tu and aminoacyltRNA. What is the biological significance of this enhancement of GTPase activity by ribosomes?. Why is a nonsense suppressor tRNATyr, even though ithas a mutant anticodon that cannot recognize a tyrosinecodon, charged with tyrosine by Tyr tRNA synthetase?If the following nucleotide sequence represents the active domain of the COVID19’s M-protein 5’ ---- 5’ GGGUACAUGGUAGCCCCCGUCGAGAAAACACCC …. 3’ a) describe a potential mutation that may occur and the mechanism that could fix it b) if the repair mechanism is faulty, explain the consequences for COVID19 & that of the infected individual
- There are no aminoacyl-tRNAs that will go to the A site of the ribosome when UGA is the codon. Is this true of false?Most of the mutations that Yanofsky recovered were missense mutations. However, Yanofsky also recovered a nonsense mutation that changed amino acid number 15 into a stop codon. This codon normally encodes Lysine. Does the recovery of this mutation support the hypothesis that this Lysine residue is critical in the function of the tryptophan synthetase protein? Why or why not?When cladosporin acts as an antibiotic working in a bacterial cell, explain the mechanism of action of cladosporin in inhibiting protein synthesis in bacteria by blocking the action of the lysyl-tRNA synthetase
- Hemophilia in the royal family was caused by the presence of a mutation in the gene for factor IX that altered the splicing of the exons and created a new stop signal in the mRNA for factor IX. Explain how a splicing mutation could produce a premature stop signal.Explain why mutations of the Arg residue in Gsα that is ADPribosylated by cholera toxin are oncogenic mutations.The protein encoded by the cystic fibrosis gene is 1480amino acids long, yet the gene spans 250 kb. How is thisdifference possible?