Q: Type of infection for the following and small info about them: E. Balantidiasis F. Sleeping…
A: Introduction An infectious disease brought on by parasites is referred to as a parasitic disease,…
Q: The equation for the decomposition rate of leaves can be written as moekt You start with 100g of…
A: Dead organisms are broken down into their basic chemicals by bacteria and fungi during the…
Q: Which of the following proteins preserves an epigenetic alteration of DNA? O MYOD O Ey O HAT…
A: Introduction Epigenetics is the study of how changes in your environment and behaviour can have an…
Q: The genetic disorder sickle-cell anemia occurs when the amino acid valine takes the place of…
A: Sickle cell anemia is a type of blood related disorder which is also known known as sickle cell…
Q: Using recycled papers and sticks, demonstrate the steps of DNA replication. Use the following…
A: During replication, a double-stranded DNA molecule is duplicated to produce two identical DNA…
Q: Which of the following BEST describes the function of the electron transport system? Energy…
A: Introduction The inner membrane of the mitochondria contains a number of chemical compounds and…
Q: Please answer fast 1. The cell wall in bacteria is designed; a. to help resist changes in…
A: We’ll answer the first question since the exact one wasn’t specified. Please submit a new question…
Q: Refer to the following illustration to answer the question. O protein A is not made because it is…
A: There are some substances (protein, carbohydrate etc) which regulates the expression of genes. For…
Q: outline the factors that negatively affect the viability of microorganisms in aerosols.
A: An aerosol is a suspension of fine solid particles or liquid droplets in air or another gas.…
Q: Below is the 5’–3’ strand of a double-stranded DNA molecule with the following nucleotide sequences…
A: Given DNA strand: 5' - CCTATGCAGTGGCCATATTCCAAAGCATAGC - 3'
Q: Match the structures associated with the brain and indicate their primary function. Midbrain B. B.…
A: The brain is a complex organ that controls every bodily function as well as thought, memory,…
Q: In the biotechnology industry, lysine is produced by fermentation using which of the following?…
A: Lysine is a alpha amino type of amino acid which is precursor for many proteins. It contain alpha…
Q: The beach mouse (Peromyscus polionotus) is a small rodent found in the southeastern United States.…
A: Introduction An organism's genotype is made up of all of its genetic components. The alleles or…
Q: Compare exons and introns. What are their significance and role in the genome organization of…
A: Introduction :- A gene's exon is a coding region that houses the data needed to produce a protein.…
Q: I. II. III. IV. 2 1 2 3 2 3 4 3 4 S 4 4 6 5 5 Hemophilia Color blindness 6 5. If IV. 1 were to have…
A: Haemophilia is a rare type of disease where clotting of blood dosent occur in a normal way. It is a…
Q: detail three microscopic techniques, one of which should be the FISH technique, which can be used to…
A: Introduction :- Microscopic techniques are the tools that are being used to visualise & study…
Q: 1. Explain how mutations occur in SARS-CoV2 and why they are conserved in the variants during…
A: Note: As per the guidelines we are answering only question one here. Please repost the other…
Q: Describe how hroughout the Games, performance-enhancing drug testing became more rigorous and…
A: Performance enhancing drug test in sports competition has became a common practice. Athletes use…
Q: How does fluid accumulate in the middle ear during otitis media?
A: A group of inflammatory diseases in the middle ear are called otitis media. The two main kinds of…
Q: the gene above is transcribed into a functional mRNA, a.) how many codons will be carried by the…
A: The process of formation of messenger RNA with the help of template strand of DNA is called…
Q: . What is the role of mast cells? Phagocytosis of foreign molecules Secrete histamine to mediate an…
A: Mast cells are one kind of white blood cell that helps to build an immune system inside a body. The…
Q: How might abnormal meiosis lead to alterations in chromosome number or structure?
A: In the unique cell division process known as meiosis, a single cell divides twice to produce four…
Q: Name of virus Papilloma viruses RNA or DNA Double stranded (ds) or Single Stranded (ss) Linear or…
A: Papilloma virus More complex natured virus. Non enveloped. Contain DNA 10% and protein 90%.…
Q: The allele for color-blindness is carried on the X chromosome. Making color blindness (a recessive…
A: The inability to identify certain colour distinctions is known as colour blindness. The retina, the…
Q: In pea plants Red (R) flower color is dominant over white (r) flower color and green seeds (G) are…
A: Introduction : When two different unit factors(alleles) are present in a single individual only one…
Q: Why does the pentose phosphate pathway take place in the cytosol? O The reagent NAD* is only found…
A: The pentose phosphate pathway is an alternative pathway to glycolysis which generates NADPH and…
Q: The proton channel of ATP synthase consists of: 8–14 pairs of α helices. 8–14 a subunits. 7 α…
A: 8-14 a subunits ADP and phosphate are converted into ATP by the mitochondrial enzyme ATP synthase,…
Q: Charles has achondroplasia dwarfism (autosomal dominant) but his wife is normal. What is the…
A:
Q: What effects does cancer have on the body?
A: It's critical to be aware that side effects differ depending on the type of cancer, the treatment,…
Q: What are the consequences of the fail of human nature (from Genesis 3)?
A: Introduction: In the Bible Genesis, 3 explains the fall of humanity. The fall of humanity was caused…
Q: Compute the cfu ml-¹ acquired from each diluent and sampling time. Fill in the table below E. coli…
A: The colony-forming unit (CFU) is a measure of the number of viable bacterial or fungal cells. In…
Q: by some type of radiation? Explain step by step with diagrams, physics, chemistry and biology
A: Free radicals are molecules with unpaired electrons. If they are formed and are not removed inside…
Q: use the units and information found on the x and y axis. Finish with a conclusion. What does it tell…
A: Introduction Predators species are the dominant organisms that kill and eat the other species called…
Q: make a data chart of 6 organisms. The 6 organisms are EMU, Liver fluke, Octopus, polar bear, raw…
A: A cladogram (from the Greek clados "branch" and gramma "character") is a diagram used in cladistics…
Q: What type of muscles are these Type 1, Type 2a or 2b? A. orbicularis oculi, Buccinator and platysma…
A: The main purpose of the muscle, which is a soft tissue in the body, is to provide power. Movement is…
Q: What is the drug of choice for patient who had S. Aureus culture? Why?
A: Staphylococcus aureus is responsible for a wide range of symptoms and illnesses. Penicillin is the…
Q: 2. If individuals from this F1 generation self-fertilize, what genotypes and phenotypes of progeny…
A: The individual genetic makeup makes the genotype, while the physical appearance that one sees due to…
Q: In radishes long radish L is dominant over short radish. A farmer cross pollinates a long radish…
A: Introduction The relationship between two variants of a gene is described as dominant. Each gene…
Q: How did the human race start?
A: Introduction :- The most numerous and ubiquitous species of primates, humans are distinguished by…
Q: Cross a mouse homozygous for white fur with a mouse homozygous for black fur
A: The condition where two identical genes are present In an individual for a particular character, is…
Q: What are the principles of microscopic morphology? How important is examining a microorganism
A: Introduction The microscope is an instrument used to observe organisms that can not be observed with…
Q: Staphylococcus aureus excretes a food poisoning toxin which, when ingested, produces nausea and…
A: Introduction: Streptococcus aureus has recognized as the most bacteria that cause disease in…
Q: A signal transduction pathway leads to the regulation of one or more cellular activities. What does…
A: Signal transduction includes the binding of ligand to a receptor.
Q: Question Antibiotics and antibacterial products have saved a countless number of lives. With all the…
A: Evolution changes the existing traits or gives rise to new traits or species.
Q: Structure of DNA double helix
A: Introduction The genetic material in humans and virtually all other species is called…
Q: Analyze the connection between body weight and the human gut flora.
A: Numerous microorganisms necessary for the body's proper operation are found in the human body. As…
Q: The cardinal has the scientific name Cardinalis cardinalis. The scientific name contains which…
A: Answer : the cardinals cardinals are at the super class level of the taxonomic level. They are…
Q: Why is the pH of the blood stream lowered during intense exercise? How do muscles obtain MORE oxygen…
A: During intense exercise, our muscles undergo anaerobic respiration due to less availability of…
Q: 2. Approximately how many chloroplasts are present in each leaf cell? 3. What byproduct of the light…
A: As per our guidelines we are not allowed to answer more than three subparts at a time please ask…
Q: What type of operon is arabinose operon? Dose the repressor bond when arabinose is I present or…
A: Introduction An operon is a functional segment of Dna that houses a collection of genes that are…
Step by step
Solved in 3 steps
- Indicate some possible ways in which foods may become contaminatedwith enteric organisms.Nonalcoholic fatty liver disease has been linked to a sugary diet. Explain?Food poisoning can be divided into two categories: food infection and food intoxication. On the basis of toxin production by bacteria, explain the difference between these two categories.