Q: In a fed-batch culture operating with intermittent addition of lactose solution, values ofthe follow...
A: Note: As per Bartleby Guidelines For Remaining Answers Please Repost The Question. Introduction: A ...
Q: 1. What are the different glands involved in a semen? 2. What is the process in the delivery of sp...
A: 1ans) Semen = sperm+accessory glands. *The glands that are involved in a semen are Accessory glands....
Q: Describe some of the evidence that supports the binding change mechanism.
A: The ATP synthase enzyme, which is located in chloroplasts and mitochondria, exhibits a binding chang...
Q: 1999 Question #2 Communication occurs among the cells in a multicellular organism. Choose three of t...
A: A... Communication between two plant cell.. cell to cell communication. Through the plasmodesmata. B...
Q: Jurse O'Riordan has to give ceftriaxone to a 5-year old weighing 18 kg. The recommended dose is 100 ...
A: The dosage of Ceftriaxone should be given is 1.8grams.
Q: Label the parts of the Amphibian Spermatogenesis and Oogenesis.
A: Oogenesis is the process of formation of ovum from germ cells in female ovaries.
Q: umetes could be produced from the following diploid genotype? AaBb answer and submit. For keyboard n...
A: Gametes are formed during meiosis and they are separated or segregated during this time. Gamete of d...
Q: Compare Class Merostomata and Class Pycnogonida
A: Merostomata is a name given to the now extinct sea scorpions or can be said Eurypterida and the hors...
Q: Activity 1.3: Complete the table. Directions: Explain and give application for each process/tools. P...
A: 1.Restriction enzyme Explanation- A restriction enzyme is a protein that recognises a specific, sho...
Q: The coding DNA strand of a gene has the following DNA sequence: 5' ATGGCGACGATAATGTTGTGTGAGTGA 3' 1)...
A: Central Dogma: It is the complete procedure of replication, transcription, and translation of DNA. T...
Q: Listed below are five amino acids. Use the genetic code to determine the exact codon for each amino ...
A: Note: As Per Guidelines, We Can Answer One Question At A Time. Ask Again To get rest answers. Intro...
Q: How is integrated disease management related to environmental conservation?
A:
Q: How does hypersecretion of growth hormone (GH) affects the body?
A: INTRODUCTION Hypersecretion of growth hormone can leads to gigantism or acromegaly.
Q: If Individual 5 mates with a homozygous recessive horse, which of the following is a valid predictio...
A: Achondroplasia as mention is an autosomal dominant trait, thus confirming that the genotype of indiv...
Q: what is an ecosystem
A: There are 4 types of ecosystems: Forest Ecosystems. Grassland Ecosystems. Tundra Ecosystems. Desert...
Q: Questions: 1- Name the different type of dialyzers. 2- What is relationship between hollow fiber por...
A: 1... Types of dialyzers cellulose triacetate (CTA), ethylene-vinyl alcohol co-polymer (EVOH), polyes...
Q: Many biology news stories refer to advances in genetics. How are the terms "genetic" and "genetic in...
A: Given: Many biology news stories refer to advances in genetics. Genetics is a branch of biology tha...
Q: Why is there need to use Normal Saline Solution?
A: According to the bartleby guidelines; if more than one question is asked in single pic;.we are only ...
Q: How are CFU (colony forming units) calculated in urine? (Hint/comment: what is the volume in urine ...
A: Answer
Q: What are the four assumptions of the Lincoln-Peterson model, and how do we make sure they are satisf...
A: Lincoln-Peterson model This model gives the ability to determine the size of the population of an in...
Q: Define Enzymes
A: Many metabolic pathways exist in the human body to maintain equilibrium. Many chemical reactions occ...
Q: ACTIVITY 1 Fill in the blanks. Read carefully and choose your answer inside the box. Fertilization Z...
A: Introduction: The process of fusion of male gamete and female gamete is called fertilization. Fertil...
Q: Why is there a need for an incubator in the lab? How about incubating cultures at room temperature? ...
A: The Incubator is an insulated device in which the conditions like temperature, humidity, pH, and man...
Q: Use your textbook or a reliable online resource to help you define the following 4 terms in your lab...
A: The substrate is any substance that reacts to the active site of an enzyme. A chemical bond is forme...
Q: Directions: Solve these genetic problems. Be sure to complete the Punnett square to show how you der...
A: The cross is made up of heterozygous and dominant individuals. They both had brown eyes. Because all...
Q: • 1. Identify the tissue. • 2. Identify the structures pointed by letter "A." • 3. Identify the stru...
A: The group of cells which function together and have same structure are called as tissues.
Q: 1999 Question #2 Communication occurs among the cells in a multicellular organism. Choose three of t...
A: Introduction The cell is life's most fundamental structural and functional unit. Cells are the build...
Q: Q6. This figure shows the sequence alignment of five (5) different Src homology 2 (SH2) domains, all...
A: sequence alingment is the method of comparing the similarities between the biological sequences pre...
Q: Region on the graph that shows that there is a threshold. Effect or Lethal 50% B D Dose (concentrati...
A: The answer for the same is Below-
Q: What is the consensus sequence of the bacterial promoter? (ΤΑΤΑAΤ 17±1 -- TTGACA O TTGACA 17±1 TATAA...
A: The promoter region of the organisms can be the Proximal promoter, core promoter, and distal promote...
Q: 3. Someone in your office has the flu. How would the social habits of your office cause other people...
A: INTRODUCTION Answer of question number 3 is given below.
Q: Microtubules and microfilaments are similar in that: Group of answer choices A. both use GTP as the...
A: Since you have asked multiple question, we will solve the first question for you. If you want any sp...
Q: If you crossed a heterozygous fruit fly with straight wings and red eyes to one with curly wings/whi...
A: A phenotypic ratio helps to determine the likelihood of a trait and is most easily determined by uti...
Q: Compare linear-quadratic and multy-target models of cell survival. What are common stuff and differe...
A: Introduction A cell survival curve is a plot of the number of cells that survive to make colonies as...
Q: How do plant react to certain change like irritation/sensitivity
A: The sensation is one of the capacities shown by a residing creature to keep up with its life, where ...
Q: Consider the following situation: The replicated chromosome 9 is separating during anaphase of mitos...
A: Introduction: A telomere is a segment of repetitive sequences found at the ends of most eukaryotes'...
Q: In glycolysis, the net production of ATP is ATP. In the Krebs cycle, it is ATP, and in the electron ...
A: ATP(Adenosine triphosphate) The nucleotide coenzyme Adenosine triphosphate is the most important f...
Q: Enumerate two conditions that may lead to transformation of cyst to trophozoite stage.
A: Introduction A parasite is an organism that lives on or in another creature and feeds on or at the e...
Q: embed an image for each type of malformations of the face. 4. Astomia ...
A: Malformations are the result of an infant's skull or facial bones fusing together too soon or in an ...
Q: Why might adding a topoisomerase enzyme increase the sensitivity of an RT-Lamp assay. Would you expe...
A: Reverse transcription-polymerase chain reaction (RT-PCR) assay is used for the detection of coronavi...
Q: You are interested in the effect of both soil copper concentration and pH on the growth of plants an...
A: The given setup is considered as one of the simplest growth setup. The growth rate is measured. The ...
Q: 5.1) Do you expect DNA strands 1 and 2 below to have the same melting point? Justify your answer. S...
A: As per bartleby guidelines we are only allowed to answer one question. Please post the other questio...
Q: It is 9 am in the morning and David has not eaten since dinner last night at 8 pm. He has fasted for...
A: Glucose The primary energy source for human body . The only source of energy for Brain and RBCs Car...
Q: How does the pandemic (COVID-19) transform the way we communicate with one another? What are the bar...
A: Covid 19 is the name given to the disease caused by the corona virus Spread -- by respiratory airdr...
Q: Consider Mendelian traits versus polygenic traits. What impact do modifications, such as those offer...
A: CRISPR-Cas9 has recently become a popular set of tools for genetic engineering. By targeting specifi...
Q: How do neurodegenerative diseases such as Alzheimer's and Parkinson's disease relate to the concept ...
A: Introduction :- The progressive loss of structure or function of neurons, known as neurodegeneration...
Q: Both ocelli and statocysts are composed in part of nerve tissue. True False
A: Answer : Both ocelli and statocysts are composed in part of nerve tissue. false.
Q: What happens if you breed a patchwork fish with a blue scaled fish? 1. P1: _________ x _________ 2...
A: Codominance is a condition ;in which the phenotypic effects of each allele is observed in the hete...
Q: The hypothesis is that since the basal metabolic rate of birds and mammals differ from one another b...
A: It refers to the total energy spent by the body of an organism in 12 hours duration, in a controlled...
Q: You are attempting to rupture cells. You systematically dilute a lysis buffer of ammonium sulfate in...
A: The term molarity is associated with the number of solute molecules present in a solution in one lit...
Step by step
Solved in 3 steps
- Characterize and give a brief description of the following bacteria: Bacteriodes fragilis Streptococcus mutansCharacterize and give a brief description of the following bacteria: Bacillus cereus Clostridium difficileDifferentiate between chemical composition of cell wall of Escherichia coli and clostridium.