Explain the mechanisms within organisms that protectthem from damage from toxic substances.

Q: Below is a Figure of a Shoot Tip, Is the encircled part a permanent tissue? True or False

A: Meristematic tissues in plants are made up of a swarm of undifferentiated cells whose sole purpose…

Q: 11.Which of the following blood vessels does not carry oxygenated blood?

A: Oxygenated and deoxygenated blood Oxygenated blood is the blood that contains oxygen or also called…

Q: 2.How does hydrochloric acid aid in the digestion of food? Read and analyze the question and choices…

A: The digestive system made up of different organs helps in the digestion of food. The stomach is the…

Q: 9. Some biologists contend that the term double fertilization is a misnomer and that the process…

A: Fertlizatiion is the process of the male gamete, sperm, fusing with the female gamete, the ovum,…

Q: Template DNA: 5’ ATGACGGAATATAAGCTGGTGGTGGTGG---GGCTGCATGAGCTGCAAGTGTGTGCTCTCCTAA 3’ 3’…

A: Template DNA: 5’ATGACGGAATATAAGCTGGTGGTGGTGGGGCTGCATGAGCTGCAAGTGTGTGCTCTCCTAA 3’…

Q: Discuss the coevolution of polydnaviruses and their mutualistic partners

A: Introduction Polydnaviruses are insect viruses that belong to the Polydnaviridae family. The family…

Q: Growth of any living organism involves the following EXCEPT a.   Increase in the number of…

A: The growth is the characteristics of living organisms. Every living organisms grow in size that is…

Q: Questions 3 and 4 refer to the following diagram. Tertiary Consumer Snake Secondary d Consumer Toad…

A: The strata is very important in various ecological cycles as it keeps the consumers and producer…

Q: 10. Given the following prokaryote sequence of DNA: Identify if any promoter sequences are present…

A: Disclaimer : Since you have posted a question with multiple subparts, we will solve first three sub…

Q: statement is true. Both statements are false. 1. Epigenetics does not consider how exposure to…

A: Epigenetics is the study of how your behaviour and environment can influence how your genes…

Q: 5. Examine the photo of the Trillium flower pictured at the right. (a) Is Trillium a monocotyledon…

A: Introduction Trillium is a genus of herbs belonging to the lily family with an upright stem…

Q: A dominant gene that codes for white hair is represented by the symbol W. If a parent with the…

A: The dominant trait is the one that first appears or is visibly seen in organism. Even if only one…

Q: Hello! What are the two drugs that have potential for treating Alzheimer’s diseases? And compare…

A: Answer :- The two drugs that have potential for treating Alzheimer’s diseases are :-  -…

Q: If a cell is placed in a solution that has the same concentration of solutes as in its cytoplasm,…

A: When a cell is submerged in an isotonic solution, there is no net movement of water entering or out…

Q: 1. The impact of diet on an individual may vary depending on the individual's genetic makeup. II.…

A: Nutrigenomics is the branch of science that investigates the link between nutrition and changes in…

Q: What is the continuous challenge that the influenza virus presents toscientists and public health…

A: Influenza refers to an acute respiratory illness that spreads from zoonotic reservoirs among aquatic…

Q: In lysogenic conversion, (a) bacterial cells may exhibit new properties (b) the host cell dies (c)…

A: A bacterium and a phage go through a process called lysogenic conversion, which is typically…

Q: If the following truncated peptide represents the active domain of the COVID19’s S-protein…

A: Mutations are alterations in the DNA sequence of an organism. Small changes, such as adding or…

Q: LESSEU Some factors have been proven to increase the risk of mutations occurring. Which of these is…

A: Introduction :- A gamma ray, also known as gamma radiation, is a penetrating form of electromagnetic…

Q: DNA transcription may be selectively regulated through alteration of the rate of protein synthesis…

A: Transcription is the process by which the information in a strand of DNA is copied into a new…

Q: 2.If Peter is allergic to peanuts and Paul is not, what is the precise molecular difference in…

A: 2. If Peter is allergic to peanuts and Paul is not, what is the precise molecular difference in…

Q: What is a single word that defines a characteristic of most Herpesviruses? Answer: I

A: Herpes virus are very hard to treat due to their complex genome despite having high quality drugs…

Q: different kinds of waste produced in a Nuclear Medicine Department.  What are the appropriate…

A: Nuclear Medicine Department The nuclear medicine department is that branch of science and medicine…

Q: Evaluate whether the statements I and II are TRUE or FALSE. A. Only the first statement is true.…

A: DNA methylation results in modifying DNA bases by methylating them. In contrast, histone acetylation…

Q: True or false. The supercontinent pangaea formed about four billion years ago.

A: A supercontinent is a landmass that contains most or all of the land on Earth. The landmass formed…

Q: The binding between the substrate and the active site of the enzyme: O Is very specific O Resemble…

A: Enzyme is a biocatalyst. It speeds up the reaction.

Q: A) For this DNA fragment "TGAATTCCCGGGTTCCGGGAATTCGCGCGAATT CCCGGTATA", what is its complementary…

A: As per our Guidelines we are not allowed to answer more than three sub parts at a time.

Q: Which of the following depicts an epigenetic change? 1. Green, variegated, and albino Agave plants…

A: Epigenetic means the trait which is not inherited but is controlled by surrounding factors. It…

Q: How many μ moles of acetaldehyde are required to allow complete oxidation of the pyruvate to 15µ…

A: the limited supply of NAD+ will deplete the reaction initially causing the reaction to stop, but…

Q: Which of the following is/are possible functions of proteins? O Receptors O Enzymes O Channels All…

A: Proteins are important nutrients for the human body. they may be one of the building blocks of body…

Q: What is the importance of surfactant in the lungs?   it reduces the surface tension of water in the…

A: Introduction Pulmonary surfactant (PS) is a protein and lipid mixture produced by alveolar type-II…

Q: Viruses occur in a. living state only b. both living and non-living states c. non-living state…

A: Virus is infectious microbe which contains a segment of nucleic acid (either DNA or RNA).  Viruses…

Q: Thomas hunt Morgan believed genetic mutations were the source if genetic issues and he expoxed flies…

A: The modern synthesis of biology defines the evolutionary theories (Mendelian genetics) that were…

Q: Trace the evolutionary origin of viruses according to current hypotheses and describe research…

A: A virus is an infectious agent that multiplies within the host body. A virus is made up of three…

Q: 1. Identical twins may show dissimilar phenotypes due to changed methylation patterns of the…

A: * monozygotic twins even they are genetically identical there will be some  variation in them the…

Q: The step(s) involved in cell signaling are: O Signaling cell synthesizes and secretes a signaling…

A: Introduction As multicellular organisms are made up of a lot of cells, there must be coordination…

Q: functi 2. A developing fetus obtains oxygen from its mother's blood. In an organ called the…

A: Fetal haemoglobin (HbF) is the type of haemoglobin that is prominent during pregnancy and has a…

Q: friend tells you the following story. "My aunt just received a heart transplant. Her doctors warned…

A: * Here a friend tells that his aunt received heart transplant and doctors warned her body might…

Q: 1. Methylation of DNA and acetylation of histones are inversely correlated. II. Methylation and…

A: The main distinction among DNA methylation and histone acetylation is that DNA methylation leads in…

Q: Match each structure with its descriptions. ____ radula                     a. internal skeleton…

A: Human anatomy and physiology are concerned with how the human body works to keep itself alive and…

Q: B. Classify the flowers whether they are regular or irregular, complete or incomplete. Observe and…

A: The external morphology of plants helps in distinguishing them from other plants. The flowers of the…

Q: You have a mouse model that is a homozygous knockout mutant for the prnp gene (Prnp protein is not…

A: knockout mouse is a genetically engineered laboratory mouse (Mus musculus) in which a specific gene…

Q: Discuss the results of the data Topic: Tests for Hydrocarbons experiment

A: In this test of hydrocarbons there is ignition testing the determine hydrocarbon the first test is…

Q: 12.Which is also known as the "voice box" which regulates the air flow into the lungs? Read and…

A: The respiratory system is a network or organs and tissues that help in gaseous exchange i.e., take…

Q: association of 2alpha and 2 beta chains to form adult hemoglobin     identify which describes the…

A: Translation is process of conversion of RNA to protein.

Q: The following is/are true about plate count EXCEPT a.   A plate count is a count of viable or live…

A: The following is/are true about plate count EXCEPT a. A plate count is a count of viable or live…

Q: 13.Why does carbon dioxide need to be transported in the form of bicarbonate ions? (This is multiple…

A: The transport of gases takes place via the blood from the lungs to tissues and vice versa. The O2 is…

Q: 15. differntial splicing allows a single gene to produce multiple proteins true or flasev

A: Alternative Splicing or Differential Splicing enables the inclusion or exclusion of particular exons…

Q: heterozygous mice for the Sd gene are shown to have relatively shorter or lack a tail true or false

A: Sd / wildtype = heterozygous = short tail  Wild type/ wild type = homozygous = long tail  Sd/Sd…

Q: Essential Elements for Plant Growth Macronutrients Micronutrients Carbon (C) Iron (Fe) Hydrogen (H)…

A: Plant nutrition involves uptake of the chemical that are necessary for plant growth. These chemical…

Immune Disorders

The collaboration between the cells and proteins that work together as a defense system against infection comprises the immune system.Each of them performs a variety of tasks to recognize and/or react against a foreign body.