4 10. Given the following prokaryote sequence of DNA:Identify if any promoter sequences are present in DNA SEQ1 (Highlight/Underlinethese in the sequence)Predict the mRNA sequence that would arise from this DNA sequence.Identify the ribosome binding site, start and stop codons (if present).(Highlight/Underline these in the sequence).Predict the sequence of the peptide that would arise from the predicted mRNAsequence using the genetic code table (see Codon usage table).Based on your knowledge of the properties of amino acids speculate on theproperties of the predicted peptide (e.g. charge, hydrophobicity, aromaticity)3'ACCGGAATTAGAATGAAACTGTTACCCCCGAACTGAAAGCTAGATATTATCGAATCCATTAACCTCCCAAAGCGTACCAATAGTATAGAGGGTGGGCCCGGCGAAATCCGATTCTGGACACTACCTGAAAGCTAG 5

Name: 4 10. Given the following prokaryote sequence of DNA:Identify if any p
Uploaded: 2024-03-20T06:42:55.000Z
Channel: Bartleby
Description: 4 10. Given the following prokaryote sequence of DNA:Identify if any promoter sequences are present in DNA SEQ1 (Highlight/Underlinethese in the sequence)Predict the mRNA sequence that would arise from this DNA sequence.Identify the ribosome binding

Disclaimer : Since you have posted a question with multiple subparts, we will solve first three sub…

Science

Biology

10. Given the following prokaryote sequence of DNA: Identify if any promoter sequences are present in DNA SEQ1 (Highlight/Underline these in the sequence) Predict the mRNA sequence that would arise from this DNA sequence. Identify the ribosome binding site, start and stop codons (if present). (Highlight/Underline these in the sequence).

10. Given the following prokaryote sequence of DNA: Identify if any promoter sequences are present in DNA SEQ1 (Highlight/Underline these in the sequence) Predict the mRNA sequence that would arise from this DNA sequence. Identify the ribosome binding site, start and stop codons (if present). (Highlight/Underline these in the sequence).

Biology: The Dynamic Science (MindTap Course List)

4th Edition

ISBN:9781305389892

Author:Peter J. Russell, Paul E. Hertz, Beverly McMillan

Publisher:Peter J. Russell, Paul E. Hertz, Beverly McMillan

Chapter15: From Dna To Protein

Section: Chapter Questions

Problem 5TYK: Which of the following statements is false? a. GTP is an energy source during various stages of...

See similar textbooks

Similar questions

The AUC and AUA codons in mRNA both specify isoleucine. What feature of the genetic code explains this? complementarity nonsense codons universality degeneracy
An unprocessed pre-mRNA has the following structure. Which of the following is not a possible size (in bp) of the mature mRNA? 205bp 180bp 150bp 100bp
A scientist mutates elF-2 to eliminate its GTP hydrolysis capability. How would this mutated form of elF-2 alter translation? Initiation factors would not be able to bind to mRNA The large ribosomal subunit would not be able to interact with itiRNA transcripts tRNAi-Met would not scan mRNA transcripts for the start codon elF-2 would not be able to interact with the small ribosomal subunit.
A part of an mRNA molecule with the sequence 5-UGC GCA-3 is being translated by a ribosome. The following activated tRNA molecules are available. tRNA Anticodon Amino Acid 3-GGC-5 Proline 3-CGU-5 Alanine 3-UGC-5 Treonine 3-CCG-5 Glycine 3-ACG-5 Cysteine 3-CGC-5 Alanine Which two of them can bind correctly to the mRNA so that a dipeptide can form? a. cysteinealanine b. prolinecysteine c. glycinecysteine d. alaninealanine e. threonineglycine
1. Considering the following nucleotide sequence in an mRNA molecule: 5’ AUG UUA CGU AAU GCU GUC GAA UCU AUU UGC UUU ACA UAA 3' a) Write the sequence of the DNA template (antisense) strand from which the mRNA was synthesized. b) Write the sequence of the DNA coding (sense or informational) strand complementary to the template strand. c) Write the sequence of tRNA anticodon that corresponds to the given mRNA molecule. d) Write the amino acid sequence of the peptide synthesized from the given mRNA nucleotide sequence. e) Draw the structure of the pertide fragment made up of the first five (5) amino acids in the given polypeptide.
7. A segment of a DNA strand consists of ...GCTTAGACCTGA.... (a) Identify the expected nucleotide order in the complementary mRNA (b) Identify the sequence of amino acids coded for by this segment of DNA. (c) Describe the bond that forms during translation to link amino acids together. Identify the functional groups that react and the atoms involved.
1. Which of the following statements about mRNA is correct?a. Eukaryotic mRNA is generally polycistronic while prokaryotic mRNA is monocistronic.b. Both prokaryotic and eukaryotic RNA is polycistronic.c. Both prokaryotic and eukaryotic RNA is monocistronic.d. Eukaryotic mRNA is generally monocistronic while prokaryotic mRNA is polycistronic. 2. Which of the following statements about leading and lagging strand synthesis is correct?a. The lagging strand can only be synthesized once the leading strand has been completedb. Lagging strand is synthesized is continuously while leading strand is synthesized fragment by fragment.c. Leading strand is synthesized is continuously while lagging strand is synthesized fragment by fragment.d. Okazaki fragments are used to synthesize the leading and lagging strands of DNA. 3. An intron of a gene had a G to T mutation on the 3’ splice site. What will happento this intron?a. The intron will not be spliced out but will not be recognized in the ribosome…
1. What is the nucleotide sequence of the mRNA transcribed from the template DNA strand: 3’-GCTACAAAAAGTCCATAATCGC-5’? Indicate the 5’ and 3’ ends. Follow the same format as the given sequence. 2. If the mRNA sequence you obtained in question 2 were to be translated, what would be the sequence of amino acids in the peptide? Use the 3-letter code of the amino acids. Separate the amino acids with a dash (-). NO NEED to indicate the N- and C-terminal amino acids. Assumption is that the first amino acid is the N-terminal. 3. If the mRNA sequence you obtained in question 2 were to be translated, what would be the sequence of amino acids in the peptide? Use the 3-letter code of the amino acids. Separate the amino acids with a dash (-). NO NEED to indicate the N- and C-terminal amino acids. The assumption is that the first amino acid is the N-terminal.
1. Classify the type of mutation that have taken place: silent, missense and nonsense as a result of a single base substitution from UCG codon which codes for cysteine:a) AGC (ser): ________b) UGU (cys): ________c) GGC (gly): _______d) UGA (stop): _______e) UUC (phen): _______2. A single base addition and a single base deletion approximately 15 bases apart in the mRNA specifying the protein lysozyme from the bacterial virus T4 caused a change in the protein fromits wil-type composition….lys-ser-pro-ser-leu-asn-ala-ala-lys…..to the mutant form lys-val-his-his-leu-met-ala-alalys.a. Decipher the segment of mRNA for both the original protein and the double mutant.b. Which base was added? Which was deleted?3. Given is the 30 nucleotides in the human gene for hemoglobin (the oxygen-carrying protein in the red blood cells): 5’ TAC-CAC-GTG-GAC-TGA-GGA-CTC-CTC-TTC-AGA 3’a. What is the complementary strand?b. Deduce the mRNA in this coding region.c. What is the amino acid sequence based on this…
1) Below are some events that occur in the process of translating mRNA into a protein in a bacterial cell. Pick the best order of events. EF-G–GTP binds to the tRNA in the A site and causes the tRNA to advance to the P site.- The rRNA in the ribosomal 30S subunit base-pairs with the Shine-Dalgarno sequence in the mRNA.- Peptide bond forms between the growing amino acid chain in the P site and the new amino acid in the A site.- IF-3 binds in the E site.- RRF binds in the A site.- RF-1 or -2 binds in the A site.- Ribosomal complex dissociates.- Peptide chain dissociates from final tRNA.- fMET tRNA binds to the start codon in the mRNA.- RF-3–GTP causes displacement of RF-1 or -2 and its exit from the ribosome.- EF-G–GTP binds to the A site and causes RRF to shift to the P site.- A conformational change in the 30S subunit allows the 50S subunit to bind, forming the 70S ribosome. Step 1, 2, 3, 4 ,5 ,6 , 7, 8, 9, 10, 11, 12
3. The sequence of bases on an mRNA strand is AAUCGACGCCCGACUAGC. List the codons present in this sequence. 4. List the tRNA anticodons that would pair with the codons present in the above sequence of mRNA. 5. Determine the translated amino acid sequence obtained from the mRNA strand given in question 3. You may use the genetic code table to translate. 6. A tRNA anticodon has the base sequence CCG. Identify the DNA base sequence that was used to produce the codon that will bind it to this anticodon. 7. Explain how you would determine whether a single chain of nucleotides is RNA or DNA. 8. Describe all the elements required to carry out the process of translation. 9. Describe the importance of DNA in determining the structure of a particular protein.
5. Consider the following DNA template strand:3’ GCA- AAA-CAA-ATA-GTG 5’Using the following sequence, identify:a. The base sequence in the DNA information strandb. Assuming that no introns are present, identify the codons present in the mRNA transcribed from the DNA template strandc. The anticodons in the tRNA that with interact with the mRNA codons in (b).d. The amino acids that will be carried by the tRNA (from c) molecules