In lysogenic conversion, (a) bacterial cells may exhibit new properties (b) the host cell dies (c) prions sometimes convert to viroids (d) reverse transcriptase transcribes DNA into RNA (e) lytic viruses become temperate

Q: Twenty snakes with the Aa genotype migrated to a population of 80 snakes of the same species with…

A: If the population is in Hardy-Weinberg equilibrium, the genotype frequencies should be 0.49 for  AA,…

Q: Examine the network motifs in Figure Q8–5.Decide which ones are negative feedback loops and whichare…

A: Introduction  Protein is the key biomolecule in the biological system, any important physiological…

Q: The primary structure of a protein is formed in the A) the RER, B) Golgi apparatus, C) nucleoid, D)…

A: Protein is a polymer of amino acids. The peptide bond is present between two amino acids.

Q: 1. Nutrigenomics is the study of how diet and gene expression interact throug molecular mechanisms.…

A: Epigenetic modifications are alterations in the genes without changing the exact or original DNA…

Q: entities that sustain parts of plant and plant sap. bio question pls answer asap

A: Prokaryotic cells lack a membrane-bound nucleus and other cell organelles (membrane-bound). Their…

Q: In fruit flies, gray body (G) is dominant to black body (g).  If a male with a black body mates with…

A: A trait is a characteristic features that is unique to particular individual . A monohybrid cross is…

Q: discuss the use of linkage maps, bionano optical mapping and Hi-C for assembly.

A: * Linkage map also called as a genetic map which is an table for a experimental population that…

Q: O Isotonic solutions. Pepsin enzyme becomes denatura Owhen pH is acidic O Temperature is very high O…

A: Temperature is very High.

Q: Cell determination is due to cytoplasmic effectors that cause the cell to irreversibly commit to…

A: Cytoplasmic determinants are special molecules which play a very important role during oocyte…

Q: Do a diagram that shows the evolution of a domesticated crop (corn or tomatoes

A: * Evolution is thd change in characteristics of a species for many generations based on natural…

Q: How would you modify the isolation of endospore-forming organisms from the soil procedure you…

A: They are major contminants of food industry. Various species such as Clostridium botulinum ,…

Q: in the human beta-globin, two introns are spliced out in order to produce the mature mRN

A: The gene regulation can be exercised at different levels where DNA can be packed tightly or loosely…

Q: How has “success” been defined? Where would the success be manifested—in individuals, in…

A: Success is defined as achievement of a desired outcome in an acceptable manner.

Q: 13. A silent mutation A) does not change the protein that is produced. B) has a very minor change on…

A: In our existing nature, the mutation is very dynamic and it subjects to various types of heritable…

Q: What are the possible interferences or sources of variability in the assay? How do these…

A: In laboratory medicine, mining, pharmacology, environmental biology, and molecular biology, an assay…

Q: Which of the following processes could be/are conducted by lysosomes? A) synthesis of mRNA B)…

A: Lysosome is an organelle found in the eukaryotic cell. It is also known as suicidal bag.

Q: functi 2. A developing fetus obtains oxygen from its mother's blood. In an organ called the…

A: Fetal haemoglobin (HbF) is the type of haemoglobin that is prominent during pregnancy and has a…

Q: urther discussion questions: a) What is the wavelength of UV light with maximal absorbance by…

A: Proteomics is a new field based on the human genome project. Proteomics is primarily concerned with…

Q: A) For this DNA fragment "TGAATTCCCGGGTTCCGGGAATTCGCGCGAATT CCCGGTATA", what is its complementary…

A: As per our Guidelines we are not allowed to answer more than three sub parts at a time.

Q: The extra energy required for the evolution of the highly complex eukaryotic cell was possible…

A: A cell is composed of several cell organelles. Besides the nucleus, mitochondria and chloroplasts…

Q: Describe the difference between carrier proteins and channel proteins. What is required for the…

A: * The channel proteins are proteins that have ability to form hydrophilic pores in cell membranes…

Q: What amino acid residues are phosphorylated on the intracellular domain of a VEGFR? Glutamic Acid…

A: VEGFR: VEGF receptors are vascular endothelial growth factor receptors (VEGF). VEGFR is divided into…

Q: In biological processes, it is often observed that various molecules interact with a functioning…

A: The term "functional protein" refers to proteins that have biological action. In animal nutrition,…

Q: What are limiting factors for steady-rate aerobic metabolism? Select 3 correct answer(s)     Fluid…

A: Steady-rate aerobic metabolism of the athlete is explained by the rate at which, the circulatory…

Q: Describe the two groups of invertebrate chordates, and draw atree showing how they relate to one…

A: Chordates contains two classes of invertebrates and one class of vertebrate. Invertebrates include…

Q: What is the continuous challenge that the influenza virus presents toscientists and public health…

A: Influenza refers to an acute respiratory illness that spreads from zoonotic reservoirs among aquatic…

Q: A dominant gene that codes for white hair is represented by the symbol W. If a parent with the…

A: The dominant trait is the one that first appears or is visibly seen in organism. Even if only one…

Q: 14. Guanine normally pairs with cytosine. Oxidative damage can result in the modification of guanine…

A: 8-Oxoguanine is one of the most common DNA lesions caused by reactive oxygen species altering…

Q: Classical evolutionary theory assumed that changeleads to improvement. T or F

A: This statement is indeed true since the earlier evolutionary scientists believed that change is what…

Q: arasympathethic stimulation of the lungs causes   bronchi to dilate bronchioles to dilate bronchi to…

A: The autonomic nervous system is divided into the parasympathetic nervous system and the sympathetic…

Q: Many eukaryote cells are NOT able to synthesize (make their own) the amino acids that they require…

A: The cell membrane is selectively permeable. It allows only certain materials to pass through it.…

Q: 1) RNA polymerase 2) sigma (o) subunit of RNA polymerase 3) rho (p) factor 4) transcription factors…

A: RNA polymerase  extend or polymerise RNA.   Sigma subunit of RNA polymerase binds to promoter…

Q: In the very first round of PCR using genomic DNA,the DNA primers prime synthesis that terminates…

A: It is a quick and versatile in vitro molecular biology technique for amplifying the defined target…

Q: 18. cell differentiation is where a cell makes an irreversible commitment to follow a specific…

A: Introduction :- The process by which dividing cells change their functional or phenotypic type is…

Q: Calibri Light (H.. v 11 A BIU ov Av A 2. Are bacteria unit- or multicellular? What about the chains…

A: Since you have not specified which question you want the answer for, we are solving question 4 for…

Q: The step(s) involved in cell signaling are: O Signaling cell synthesizes and secretes a signaling…

A: Introduction As multicellular organisms are made up of a lot of cells, there must be coordination…

Q: Which of the following is associated with intracellular nuclear receptors? O Transcription factors O…

A: Intracellular receptors are biomolecules that can be found in the cytosol as unbound and soluble…

Q: Within the eukaryotic cell, the source of most of the energy stored in ATP is produced through the:…

A: Introduction - Organisms with a nucleus and other membrane-bound organelles are known as eukaryotes.…

Q: The RNA-induced silencing comp (RISC) I. binds to and unwinds ds siRNA/miRNA to produce ss…

A: A multiprotein complex called RISC contains one string of a small interfering RNA (siRNA) or micro…

Q: Identify three characteristics used to classify viruses.

A:

Q: Write a detail note on "Management of PH in individuals in O2" ?

A: Homeostasis refers to the process of maintaining internal physiological parameters in a changing…

Q: formation of different cellular phenotypes is due to the equal distribution of the cytoplasmic…

A: Phenotype shows the appearance of individual.  genotypes shows the genetic type.

Q: Twenty snakes with the Aa genotype migrated to a population of 80 snakes of the same species with…

A: Hardy-Weinberg Equilibrium is a concept that researchers use to analyze gene evolution in a specific…

Q: statement is true. Both statements are false. 1. Epigenetics does not consider how exposure to…

A: Epigenetics is the study of how your behaviour and environment can influence how your genes…

Q: The fact that a prokaryote has the ability to make a new protein that is placed in the cell membrane…

A: Prokaryotes are organisms in which cell do not have nucleus and organelles.  Prokaryotes are further…

Q: 18. Which of the following entities has the largest interaction cross-section (most likely to…

A: Tissues are group of cells having similar function and structure.

Q: Please answer the following statements with true or false True False Peripheral proteins interact…

A:

Q: Dideoxy sequencing is one of the most important methods for DNA sequencing. What could be the impact…

A: The biological methods for establishing the arrangement of the nucleotides in a DNA oligonucleotide…

Q: 5. Larry and Lola Little have achondroplasia, a form of dwarfism. Both are heterozygotes. Their son,…

A: Heterozygous condition is defined as a condition in which two variations of a gene known as alleles…

Q: 1. Epigenetic marks established at infancy will persist throughout an individual's lifespan. II.…

A: As a result, vitamins and biologically active components can transiently modify DNA methylation…

Viral Infections

Viruses are abundantly found, minute entities that have genetic material enclosed within a protein coat. The proteinaceous material enclosing the genetic material of the virus is called a capsid. The genetic material could be either DNA (deoxyribonucleic acid) or RNA (ribonucleic acid). A virus is too minute to be looked at with naked eyes and therefore visualized with the help of a microscope. They are acellular entities that require a host for processes, such as replication, transcription, translation and multiplication. Plants, animals, and bacteria act as host wherein the virus reproduce. Viruses cannot multiply outside the host's body and thus are considered nonliving outside the host body.