Look at the MRNA strand below. There are at least a few bases before the "AUG" or the start codon. Why is it important that "AUG" or the start codon NOT be the first 3 nucleotides of the mRNA sequence?

Q: How many different mRNA sequences can encode a polypeptide chain with the amino acid sequence…

A: Polypeptide chain includes a sequence of amino acids that are coded by different codons during the…

Q: AAAC G CA G CCG Phe Gly Arg

A: In this image, we are shown the formation of proteins from DNA by following the central dogma of…

Q: Translation begins with the_______ codon of mRNAand continues until a(n)_______ codon is reached.…

A: For the expression of a gene, the sequence present in a DNA molecule must be converted into a RNA…

Q: Sequence of nucleotides in MRNA|AUGCGUUCAUGGACU Sequence of amino acids in protein

A: Sequence of nucleotide in mRNA  AUGCGUUCAUGGACU is given .

Q: The DNA sequence contains the complete sequence for a small gene. What amino acid sequence does this…

A: DNA sequence of genes code for the sequence of amino acids in proteins. There are two strands in…

Q: Write the order of nucleotides in mRNA that would be transcribed from the following strand of DNA:…

A: Hi, Thanks For Your Question.  Answer : Let's Learn Some Basic Concepts First: Transcription : It Is…

Q: If a tRNA molecule has an anticodon which reads AUG what was the codon of the mRNA MOLECULE

A: tRNA is also called a transfer RNA. It is a secondary structure of RNA having stem loops. It is a…

Q: If the base sequence of template strand reads GCCATTAC, what is the base sequence of the mRNA? O A)…

A:

Q: The figure represents tRNA that recognizes and binds a particular amino acid (in this instance,…

A: Your answer is incorrect and the correct answer is 5'-UUC-3' This is because the amino acid…

Q: Explain why the statement is correct. A section of the mRNA has a nucleotide sequence of…

A: mRNA  A single stranded RNA which is copied from DNA and contains gene or information about specific…

Q: A mutation takes place during replication and the new DNA strand has the sequence 3'-ATG-5' What is…

A: The genetic code is a triplet code called a codon. The indicated amino acid can be specified by more…

Q: The sequence below is an mRNA strand that is in the cytoplasm ready to translated by a ribosome. If…

A: Translation is the process of formation of a protein chain from a RNA chain. Translation requires an…

Q: Consider a portion of a gene in a cell with the sequence TTTTT. Which of the following bases would…

A: The correct answer is C) A-A-A-A-A; nucleus .

Q: Which of the following is NOT found on a mature eukaryotic mRNA molecule? (Choose all that apply)…

A:

Q: Can you give further explanations regarding this topic? We are about to tackle this in our next…

A: Our DNA is made up of four bases which are A= Adenine, C= Cytosine, G= Guanine, and T= Thymine. Here…

Q: mRNA binds to a ribosome. Transcription completes. mRNA leaves the nucleus. tRNA attaches to the…

A: DNA translation is the term used to portray the course of protein synthesis by ribosomes in the…

Q: The first amino acid in a purified bacterial protein is methionine. The start codon in the mRNA is…

A: The process of protein(amino acid) formation is called translation and it is the last step of the…

Q: In the diagram below (Figure 22), fill in the terms in the appropriate places indicated by a letter.…

A: This represents central dogma of molecular biology. It shows the flow of genetic information from…

Q: Which sequences are spliced out of the mRNA strand before leaving the nucleus?  In other words,…

A: Answer: TRANSCRIPTION : It is the process in central dogma where a DNA strand is transcribed in to…

Q: Transcribe the following DNA strand into mRNA and translate that strand into a polypeptide chain,…

A: DNA and RNA are nucleic acids present in the organisms. DNA is the deoxy ribose nucleic acid whereas…

Q: Suppose that section x, y, and z of the following hypothetical DNA strand are the exon (coding…

A: Exons and introns are nucleotide sequences within a gene. Exons are the coding sections of a gene…

Q: Choose the option that goes with the blank. The parentheses after the blank are the choices.…

A: In the process of synthesis of proteins from DNA, the information in DNA is used for the synthesis…

Q: A scientist sequencing mRNA identifies the following strand:…

A: mRNA is termed as messenger RNA. It is a single stranded RNA used in the synthesis of protein.mRNA…

Q: If the DNA strand has nitrogenous base sequence ATTGCC, the mRNA will have?

A: The transcription is a process of conversion of DNA to mRNA using RNA polymerase enzymes which…

Q: Give two examples of places you could have mutations in the DNA sequence of a eukaryotic gene that…

A: The change in the heritable characteristics of the species across many generations is called…

Q: In picture a (look at picture) a tRNA is already bound to the initiator codon at the start of the…

A: Translation is the process of synthesis of polypeptides (protein)  by combining monomers units…

Q: DNA gene TAC AGC TTT mRNA codon (No thymine in RNA!)       tRNA anticodon (No thymine in…

A: According to Bartleby guidelines, the first three questions have been answered. Kindly post the…

Q: If mRNA is complementary to the DNA template strand and the DNA template strand is complementary to…

A: During the process of transcription, the template strand or non-coding strand of DNA molecule gives…

Q: What is the sequence of bases in the template strand of DNA that codes for the mRNA in Problem?

A: The sequence of mRNA given in the problem is 5'AAA GUU GGC UAC CCC GGA AUG GUG GUC 3' and the…

Q: If a sequence of bases on a DNA molecule is GATTACA, what would complimentary MRNA strand look like?…

A: The sequence of bases on a DNA molecule GATTACA the mRNA sequence will be CUAAUGU. Option B

Q: Figure 3 represents one process that occurs during protein synthesis. amino acid - molecule Q A UGC…

A: Note - Since you have posted a question with multiple sub-parts, we will solve the first three…

Q: Below is the 5’–3’ strand of a double-stranded DNA molecule with the following nucleotide sequences…

A: Given DNA strand:  5' - CCTATGCAGTGGCCATATTCCAAAGCATAGC - 3'

Q: What is the effect of the insertion of a nucleotide in the 4th codon of the DNA sequence below?…

A: There are two strands of DNA :- template and coding strand . Template strand read in 3' to 5'…

Q: (a) Write the complementary base sequence for the matching strand in the DNA section shown below:.…

A: Introduction According to Chargaff's rules, DNA from any cell of any organism should have a 1:1…

Q: Which three codons would code for a different amino acid sequence from that coded for by the mRNA…

A: Given: mRNA base sequence: AGU-UCA-CCA Have to determine which three codons will code for a…

Q: RNA polymerase will attach with what sequence(s) and begin to make RNA? Anticodon Promotor stop…

A: DNA and RNA are nucleic acids present in the organisms. DNA is the deoxy ribose nucleic acid whereas…

Q: Look at Table 26.3 and find codons for the following amino acids:(a) Val (b) Arg (c) Ser

A: Codons are the triplet base of the nucleotide sequence, which encodes the amino acids during…

Q: A scientist while sequencing mrna identifies the following strand…

A: Translation is the process by which polypeptides are synthesized from a mRNA transcript which is…

Q: Now imagine that a mutation occurred in the g of the codon below and the G became a C. How would…

A: a mutation occurred in the g of the codon below and the G became a C   A  T  G Changes to A  T  C…

Q: following is a series of DNA triplets. first, transcribe the correct complementary sequence of mRNA…

A: DNA is the genetic material in most living organisms. It is the information hub of the cell that…

Q: In the image below, what is the C label pointing to?

A: The above image represents transcription where the RNA polymerase move along the DNA and make the…

Q: Draw a picture showing the sticky ends that are produced by BamHI digestion (BamHI cuts between the…

A: Enzymes that can cleave the DNA at specific sites are known as restriction enzymes. There are two…

Q: Each one gives some basic information and summarizes its main role in translation.   rRNA:…

A: The synthesis of protein or polypeptide chain from the mRNA sequence (that contain genetic codon) is…

Q: DNA DNA Complimentary MRNA sequence tRNA sequence Amino acid code Strand A т G А A A G T А T т T А G

A: Gene expression is the process by which the information from a gene is used in the synthesis of a…

Q: Which type of RNA best fits each of the statements below, respectively? MRNA, FRNA, MRNA, TRNA,…

A: RNA or the ribonucleic acid is a type of nucleic acid that is present in the cell usually…

Q: If the following were part of a DNA chain, what mRNA bases would pair with it to transcribe the DNA…

A: INTRODUCTION The carrier of genetic information within a cell is DNA, which stands for…

Q: transcribe the following DNA strand into mRNA and translate that strand into a polypeptide chain,…

A: DNA and RNA are nucleic acids present in the organisms. DNA is the deoxy ribose nucleic acid whereas…

Q: A function of transfer RNA (TRNA) is to: copy DNA and carry the information to the ribosome carry…

A: By central dogma of molecular biology, the DNA (deoxyribonucleic acid) is first replicated to form…