Extragenomic DNA Plasmid Ori F+ plasmid F factor Sex pilus Hfr = = Origin of replication. = A large pilus produced by an F+ donor bacterium allowing it to hold on to a recipient bacterium during the process of horizontal gene transfer. = Small extragenomic circle of DNA that contains a fertility factor that promotes conjugation. Genetic information exclusive of the nuclear or nucleoid chromosomse(s).. A set of genes in a plasmid that contain an ori and oriV and tra-proteins. The DNA naturally occurring inside a host cell. A circular ring of extragenomic DNA characteristic of prokaryotic cells.

Extragenomic DNA Plasmid Ori F+ plasmid F factor Sex pilus Hfr = = Origin of replication. = A large pilus produced by an F+ donor bacterium allowing it to hold on to a recipient bacterium during the process of horizontal gene transfer. = Small extragenomic circle of DNA that contains a fertility factor that promotes conjugation. Genetic information exclusive of the nuclear or nucleoid chromosomse(s).. A set of genes in a plasmid that contain an ori and oriV and tra-proteins. The DNA naturally occurring inside a host cell. A circular ring of extragenomic DNA characteristic of prokaryotic cells.

Human Heredity: Principles and Issues (MindTap Course List)

11th Edition

ISBN:9781305251052

Author:Michael Cummings

Publisher:Michael Cummings

Chapter8: The Structure, Replication, And Chromosomal Organization Of Dna

Section: Chapter Questions

Problem 3QP

See similar textbooks

Similar questions

#4 BamI --- 5’ CCTAG ↓G 3’ 5’ ACGCCTAGGACGTATTATCCTAGGTAT CCGCCGCCGT CATCA 3’ 3’ TGCGGATCCTGCATAATAGGATCCATAGGCGGCGGCAGTAGT 5’ Restriction enzyme: Recognition sequence: Number of pieces of DNA: Type of cut:
Recombinational repair is often due toa) Incorporation of many incorrect nucleotides by DNA polb) Many cystidine dimer and associated large gaps in a strandc) Many thymidine dimer formation and associated large gaps in a strandd) All of these
A linear DNA fragment and a plasmid has three restriction sites for EcoRIhow many fragments will be produced from linear DNA and plasmid respectively.
Define the following terms:a. processivityb. replisomec. exonucleased. DNA ligasee. replication fork
#1 HindII --- 5’ GTC ↓ GAC 3’ 5’ ACGACGTAGTCGACTTATTAT GTCGACCCGCCGCGTGTCGACCATCA 3’ 3’ TGCTGCATCAGCTGAATAATACAGCTGGGCGGCGCACAGCTGGTAGT 5’ Restriction enzyme: Recognition sequence: Number of pieces of DNA: Type of cut:
Which of the following statements is false?a) The cells which take up recombinant plasmids are drug resistantb) The cells with no recombinant plasmids are drug resistantc) Plasmid replication is independent of cell’s divisiond) The cells containing recombinant plasmid are called transformed cells
The line below depicts a DNA segment from a eukaryote. In this case, only the top, coding strand, is shown which is ok for our purposes (but remember that the other strand would also be present in DNAà but it is ok for us to ignore). This is very similar to a problem on the old tests. For each letter state the structure or the function of what occurs at that region. Letter A is Letter B is Letter C is Letter D is Letter E is Letter F is Letter G is To which region/letter would RNA Polymerase bind To which region/letter GTF bind Label the position of the start codon ATG and the stop codon TGA The picture below is for the question itself
Which of the following statements is not correct for telomere. Group of answer choices Telomerase consists of direct repeat sequence. Telomerase elongates the parental DNA strand in 3’-to-5’ direction. Telomerase levels are generally kept very low. Telomerase is unique because it contains an RNA molecule.
...... doesn't need during vitro transcription dna template s dNTPs rns polymerase all none
The extra chromosomal, self-replicating, closed, double stranded and circular DNA molecule is generally termed asa) Chromosomeb) Plasmidc) Genomic DNAd) Bacteriophage
You isolated a 10,500 base pair plasmid (supercoiled, cccDNA) from E. coli. The plasmid contains one unique recognition site for EcoRI, a restriction enzyme. Restriction enzymes recognize a specific sequence and cut both strands of the DNA at that sequence (Chapter 7). Brief DNase I treatment breaks one (or very few) phosphodiesterbonds in each DNA molecule, leaving the double-stranded DNA with one strand broken but the other strand intact, i.e “nicked.” You briefly incubated the cccDNA at 37°C in four separate reactions containing the components listed below. You ran each reaction sample on an agarose gel and visualized the DNA using ethidium bromide and UV light. The reactions included the appropriate buffer and ATP when required. An agarose gel containing four lanes of possible products is given below. Please refer to Figs. 4-26 and 4-27 in Watson for reference. For each reaction, indicate which lane of the gel contains the products that you would expect to see on your…
Define the following terms:a. Chargaff’s rulesb. constitutive heterochromatinc. bacteriophaged. replication-dependent histonese. replication-independent histones