For another project, you designed primers 1 and 2 with the sequences shown below. Your lab partner suggests you calculate the primer melting temperatures (Tm) using the formula: Tm = [(A+T) x 2°C] + [(G+C) x 4°C]. Calculate the Tm for Primers 1 and 2 and give your answers in the boxes provided below. You must give your answer as a whole number (no decimal places). Units (°C) are already shown so must not be included in your answer. Primer 1 (forward): 5' TTCGTCTGGTGAACTCAG 3' °C Primer 2 (reverse): 5' CAGGGTATGTCCGTATAT 3' °C

For another project, you designed primers 1 and 2 with the sequences shown below. Your lab partner suggests you calculate the primer melting temperatures (Tm) using the formula: Tm = [(A+T) x 2°C] + [(G+C) x 4°C]. Calculate the Tm for Primers 1 and 2 and give your answers in the boxes provided below. You must give your answer as a whole number (no decimal places). Units (°C) are already shown so must not be included in your answer. Primer 1 (forward): 5' TTCGTCTGGTGAACTCAG 3' °C Primer 2 (reverse): 5' CAGGGTATGTCCGTATAT 3' °C

Biomedical Instrumentation Systems

1st Edition

ISBN:9781133478294

Author:Chatterjee

Publisher:Chatterjee

Chapter13: Artifacts And Noise In Medical Instrumentation

Section: Chapter Questions

Problem 7P

See similar textbooks

Similar questions

Using the Dynamic Programming algorithm for pairwise local alignment we covered in class, construct the dynamic programming score table for a local alignment of the following two sequences, using the following scoring parameters: match score = +5, mismatch score = -3, gap penalty = -2.: ACGTATCGCGTATA GATGCTCTCGGAAAWhat is score of the best local alignment between these two sequences? Show the alignment of these sequences. asap
A duplex DNA molecule contains a random sequence of the four nucleotides with equal proportions of each. What is the average spacing between consecutive occurrences of the sequence 5'-ATGC-3'? Between consecutive occurrences of the sequence 5'-TACGGC-3'?
The plot shows a correlation between sequence error rate and cluster density on an Illumina flow cell. From your knowledge of how Illumina sequencing works, why do you think there is this correlation?
Are the following base sequences sticky or not sticky? Each piece is written 5′ to 3′.(a) TTAGC and GCTAA(b) CGTACG and CCTTCG
What is the concentration of a DNA solution that absorbs 0.812 and 0.463 at 260 and 280 nm, respectively? Is the DNA solution considered to be good quality? Why or why not?
Which of the following (A through E ) would you expect to find in a nucleotide chain constructed for Sanger sequencing?
What are degenerate primers? Name two uses for degenerate primers.
For the following sequence, what is the Tm? 5'-AGCTACGATCAGGTCA-3'
For the following sequence please design an 18 base pair REVERSE primer. ATGGCTGATAAGATAGAGAGGCATACTTTCAAGGTCTTCAATCAAGATTTCGAAAAAGAGCTGGAGTTTGGATTAGATAGAAAATATTTTTAG
which substitution matrix would you choose for a BLASTP search? justify your choice.
What are the advantages and disadvantages of using indented and bracket type dichotomous key? What are some key points, based on your work, in constructing a dichotomous key?
I know I need to plot a Lineweaver-Burk plot, but the manual way I'm trying doesn't make sense. I'm seeing elsewhere that the x-intercept is 0.8 and the slope is 0.32 but I have no idea how those are being found. Could I get a step by step walkthrough of how I plot this in order to get the line equation? Or is there a way to plot it on a graphing calculator?