choose your answer...choose your answer...post-translationaltranscriptionalpost-transcriptional Selectfrom the drop-down menu which type of regulation is occurring in each case.The Ixb12 gene sequence is in a region of condensed chromatin in fetal heart cells, but in adult heart cells, this region is uncondensed. This is an example ofchoose your answer...regulation. The Ixb12 protein is activated by a kinase, which is an example of choose your answer...regulation. Trx25 mRNA is targeted for degradation by a protein that is present in liver cells but not in heart cells, which is an example ofregulation. The Trx25 protein is inactivated by a protein that removes its phosphorylated residues, which is an example ofchoose your answer...choose your answer...regulation.

Gene regulation is a mechanism of controlling the function of gene and it's associated mRNA and…

from the drop-down menu which type of regulation is occurring in each case. Select The Ixb12 gene sequence is in a region of condensed chromatin in fetal heart cells, but in adult heart cells, this region is uncondensed. This is an example of choose your answer... regulation. The lxb12 protein is activated by a kinase, which is an example of choose your answer... regulation. Trx25 mRNA is targeted for degradation by a protein that is present in liver cells but not in heart cells, which is an example of choose your answer... regulation. The Trx25 protein is inactivated by a protein that removes its phosphorylated residues, which is an example of choose your answer... ✓ regulation.

from the drop-down menu which type of regulation is occurring in each case. Select The Ixb12 gene sequence is in a region of condensed chromatin in fetal heart cells, but in adult heart cells, this region is uncondensed. This is an example of choose your answer... regulation. The lxb12 protein is activated by a kinase, which is an example of choose your answer... regulation. Trx25 mRNA is targeted for degradation by a protein that is present in liver cells but not in heart cells, which is an example of choose your answer... regulation. The Trx25 protein is inactivated by a protein that removes its phosphorylated residues, which is an example of choose your answer... ✓ regulation.

Biology 2e

2nd Edition

ISBN:9781947172517

Author:Matthew Douglas, Jung Choi, Mary Ann Clark

Publisher:Matthew Douglas, Jung Choi, Mary Ann Clark

Chapter9: Cell Communication

Section: Chapter Questions

Problem 1VCQ: Figure 9.8 HER2 is a receptor tyrosine kinase. In 30 percent of human breast cancers, HER2 is...

See similar textbooks

Similar questions

While investigating the function of a specific growth factor receptor gene from humans, researchers found that two types of proteins are synthesized from this gene. A larger protein containing a membrane spanning domain recognizes growth factors at the cell surface, stimulating a specific downstream signaling pathway. In contrast, a related, smaller protein is secreted from the cell and binds available growth factor circulating in the blood, thus inhibiting the downstream signaling pathway. Speculate on how the cell synthesizes these disparate proteins.
Expression of ---- does not require new protein synthesis. a.immediate early genes b. delayed early genes c. late genes. One growth factor can activate different pathways because ---- a. growth factor receptor dimerizes b. receptor transphosphorylates c. each receptor binds to several different proteins that have SH2 domains d. structural changes occur in proteins of signal transduction pathway. According to Knudson’s two-hit hypothesis, in children with familial retinoblastoma, a. only a single somatic mutation is needed to eliminate Rb function. b. children have genetically wild type gene at the Rb locus, and retinoblastoma development requires two successive somatic mutations c. both a and b are a possibility Methylation of a promoter results in a. overexpression of the downstream gene b. suppression of expression of the downstream gene.
What is cell differentiation? Discuss the role of myogenic bHLH proteins in the differentiation of muscle cells. Explain how they work at the molecular level. In your answer, explain how protein dimerization is key to gene regulation.
ATM is a kinase that phosphorylates histone H2AX in response to double-stranded DNA breaks. Which of the following scenarios would most quickly regulate ATM activity in the cell? a) Adding silencing methyl groups to cytosines in the Atm gene b) Modifying the histone code for the Atm gene c) Increasing expression of a miRNA specific for the Atm mRNA d) Activating an E3 ubiquitin ligase specific for the ATM protein
Given the following schematic for a gene and its associated regulatory regions, answer the following questions by placing the correct letter in the provided blanks please put in the correct letter for the questions What region would provide cell type-specific expression of genes? region What site would significantly increase gene expression rates? = region What region or regions of this gene’s coding sequence are expressed as amino acids = region
What is a second messenger? What are two second messengers that are involved in signaling pathways downstream of GPCRs and explain how they are produced? long answer: If you wanted to compare a cardiac muscle cell with a skeletal muscle, how could you use RNA sequencing to identify genes that are differentially expressed? In your answer, explain this technique and describe what type of information you can learn from it. If RNA sequencing led to the identification of two genes, gene X and gene Y, what are two experiments you could do to study the functions of these two genes?
Which of the following defects in RAS would be tumorigenic? multiple answers A. Deletion of nucleotide binding domain B. Inactivation of Guanine Exchange Factor (GEF) C. Mutation at amino acid 61 that prevents hydrolysis of bound GTP D. Inactivation of GTPase Protein (GAPS) E. Mutation that prevents binding of GTP
TGF-β1 is a protein that affects cell growth and differentiation. Scientists conducted an experiment where epithelial cells were treated with transforming growth factor beta 1 (TGF-β1) in the laboratory. At the end of the experiment, the epithelial cells had transformed through several stages from epithelial cells to embryonic stem cells (ESCs) to neural progenitor cells (NPCs), and finally to cortical neurons (CNs). The scientists observed the transformation of the cells by analyzing gene expression at certain stages (M1-M7) and determined the relative gene expression level, as shown in the graph. The graph shows the relative gene expression level for cells at different stages of differentiation. Which of the following claims could account for the differences in gene expression at each stage of cell differentiation, and how does this correlate with the distance of the genes on the chromosome? A - Cell differentiation is controlled by RNA translation, but there is no…
Which statements decribe the function of the protein encoded by this gene CAGATTGTGAAGAGGTCTCTTGA? A. Break point cluster region protein that may function as a GTPase B. A coagulation factor C. An enzyme involved in the breakdown of glycosaminoglycans (GAGs) D. Transcription factor involved in the DNA damage response E. A component of hemoglobin F. A tyrosine kinase G. Serine/threonine kinase involved in the DNA damage response H. A tumor suppressor involved in WNT signalling I. A DNA repair enzyme involved in nucleotide excision repair
A second hit might occur through epigenetic alterations. In the promoter of RB1, there is a CpG island. Knowing this, how might you predict that a cell could epigenetically inactivate RB1 transcription?
Which of the following consequences of mutations would likely to be associated with an increased cancer risk? (select all that apply)? A. Truncation of the EGF receptor B. Constitutive activation of K-Ras C. Amplification of myc D. Truncation of H-Ras due to a premature stop codon E. Amplification of ErbB2
You are researching the regulation of cell-size control and discover that a signaling pathway that acts through a particular enzyme-coupled receptor is important for the size growth (enlargement) of rat kidney cells. Receptor activation causes activation of adenylyl cyclase, which ultimately leads to the activation of PKA. PKA then phosphorylates a transcription factor called BTS on threonine 84. This phosphorylation is required to allow BTS to bind to specific regulatory DNA sequences, increasing the transcription of Zrt2, a gene encoding a protein vital for kidney cell growth. You find that kidney cells without this receptor are 25% smaller than normal cells. When you measure cells expressing a constitutively active version of PKA, you find they are 25% bigger than normal kidney cells. Based on these results, predict whether a kidney cell’s size would be bigger or smaller than normal kidney cells in each of the following circumstances. Explain why in 1-2 sentences for each. You…