function of bile

Q: He then ran the sample on an agarose gel and observed a strong band at approximately 400bp. What…

A: The band represent a small piece of DNA that was cut with restriction endonuclease and then…

Q: Describe the process of Translation of MRNA to DNA.

A: The process of the process from a DNA strand into a new RNA ( mRNA ) molecule is known as…

Q: role of the nervous system and genes in intellectual disability?

A: Nervous system is one of the most important system in living organisms among all other systems, it…

Q: cycle was thể first etabolic cycle to be Vered, predating the description of the citric cle by 5…

A: Urea cycle began inside the mitochondria of liver hepatocytes but three of the steps occur in the…

Q: True or False:  1. Lytic viruses utilize the host’s machines to construct their viral components…

A: The term 'virus' is derived from the same word in Latin, meaning venom or poisonous fluid. It was…

Q: mystery compound, compound B. You add it to the dish with your hippocampal circuit. You fire the…

A: EPSP is excitatory post synaptic potential which is initiated by the movement of positively charge…

Q: Differentiate flexion from torsion. Why do these events occur in the developing embryo?

A: Answer--

Q: How can Ghana increase production of Papain

A: Papain is the enzyme mainly proteolytic enzyme, has great importance. Papain is extracted from the…

Q: Your company has just discovered a new Intervention X that will easily detect early stages of breast…

A: Introduction Healthcare industry:- It is an integration of sectors within the economic system that…

Q: What are the physiological changes that can occur when an individual adds resistance training to…

A: Introduction Resistance training is any exercise that causes the muscles to contract against an…

Q: Shown below are photomicrographs of Rhoeo tradescantia cells undergoing meiosis. Answer the…

A: Introduction Mitosis is the division of replicated chromosomes into two new nuclei during the cell…

Q: How does exercise influence postprandial lipemia and hyperglycemia? What is a mitochondrial…

A: Exercise also aids in the reduction and alleviation of pre-existing health problems. Exercising…

Q: Question 53 Protists (Kingdom Protista) can be: O none of the choices are correct O autotrophic O…

A: We will answer the first question as question number that needs to be solved is not mentioned.…

Q: (Select one answer from dropdown menu and fill in the blanks:) When a sperm and an egg cell called a…

A: The mechanisms that work to stimulate or suppress the transcription of a gene are referred to as…

Q: Complete the table. Calculate the size of a theoretical population of E. Coli, if given unlimited…

A: The generation time of the given bacteria Escherichia coli is 20 minutes. This means that every 20…

Q: 8. What Is the plcture below illustrating? plart Easier bluebird red-aled huwk 9. Interconnected…

A: As per our company guideline we are supposed to answer only first question or first 3 subparts of…

Q: Total eradication of disease through immunization is only possible if humans are the sole vectors of…

A: ANSWER) TRUE By the process of immunization the immunity against the disease can be developed in the…

Q: A researcher wants to cut this piece of linear DNA. 5 AGCTAGTCCGGATCCGAGGGCCCTTCTCATGAGATCCGGATGACC…

A: The discovery of restriction enzymes in 1968 by Swiss scientist "Werner Arber" ushered in the era of…

Q: Explain what happens to urine flow rate, specific gravity and urinary excretion of chloride in each…

A: As it is mentioned in the question the intake is isotonic that means the osmolarity of the intake…

Q: 2. During what phase does DNA replication occur in? (Select one answer from dropdown menu:) Choose…

A: DNA replication is semiconservative in nature, where each daughter DNA molecule has one parent…

Q: During activation, there is a secondary exchange of signals between the presenting cell & activated…

A: During activation , there is a secondary exchange of signal between presenting cell and…

Q: O been genetically modified due to errors in the nucleotides in the pare O temporarily lost its…

A: Reversible denaturation is the process in which the protein function is lost for the time being. The…

Q: How can a person reduce their own food waste? O Use clean energy in food production facilities and…

A: Only buy food if you have a limited supply.Don't overcook your food.Refrigeration is a good way to…

Q: septic shock is a life -threateningcondition caused by an overwhelming A inflammatory…

A: C.  most suitable answer is.. Failure of blood clotting cascade.

Q: Explain in detail how phosphorylation of retinoblastoma (rb) protein leads to transition of the cell…

A: The RB1 (retinoblastoma 1) gene codes protein called pRb. It is a tumor suppressor gene (genes whose…

Q: Metabolic syndrome is a clustering of various conditions including high blood pressure, high blood…

A: Satiety is feeling of fullness. Thus insulin causes satiety meaning that it induces the increasing…

Q: vessel.   Viscosity has implications on the flow rate through a tube or vessel.  Viscosity of plasma…

A: High viscosity of blood indicates the low blood flow and high blood pressure which is abnormal…

Q: Which of the following signs is most often observed in acute and chronic alcoholism? OA. Barret…

A: Alcohol poisoning is a condition caused by the rapid and excessive consumption of alcoholic…

Q: 2. The largest population an ecosystem can support is the carrying capacity determine by the which…

A: Ans: 2 Carrying capacity, limiting factors  Explanation: The largest population an ecosystem can…

Q: What makes molluscs different from other invertebrate phyla?

A: Introduction Molluscs:- Mollusca is the second-largest phylum of invertebrate animals after the…

Q: what two reactants are combined to form a molecule of ATP?

A: what two reactants are combined to form a molecule of ATP? Introduction: The essential molecule for…

Q: Which statement is true about RNA polymerase (which is required for transcription)? A. RNA…

A: Transcription  It is the process through which the sequences in strand of DNA forms into the…

Q: Punctuated Equilibrium is a hypothesis that ... O suggests that evolution is not gradual but occurs…

A: Punctuated equilibrium is a hypothesis that evolution of a species is marked by sudden isolated…

Q: What is the source of agarose, the powder used to make the gel?                        What is the…

A: Gel electrophoresis is a technique used by scientists to separate DNA or protein molecules.  Gel…

Q: A. Complete the table below by filling in the information you have learned from the concept on the…

A: Cell is the structural and functional unit of life.  Cell can be prokaryotic (without nucleus) or…

Q: Define epigenetic inheritance

A: Epignetic markers in the cell occurs in the form of DNA methylation, histone tail modifications like…

Q: hat features of molluscs appear in other invertebrate phyla? Explain

A: The most common properties of mollusks are covers with various vital openings used for breathing and…

Q: produce a diagram of the replication of a viral genome of stranded RNA simple [+] and mRNA…

A: According to the answering guidelines, I'm going answer 1st three parts of the question. Please post…

Q: In order for transcription to begin, the DNA-duplex must be "opened" to allow RNA polymerase access…

A: The self replicating by molecules that is present in the chromosomes and carrying genetic…

Q: 5. What happens to the population density in a declining po a. It decreases. b. It increases. c. It…

A: Population density can be calculated by three different methods they are arithmetic, physiological…

Q: Explain how scaffold proteins help the efficiency of the AMP kinase cascade. Why is it important…

A: The scaffold protein plays a key role in providing the platform for the specific…

Q: Questions 1. Explain why it was important to transfer the smallest colonies of yeast to the…

A: The preparation of culture plate is very much important in microbiology laboratories. Proper plating…

Q: Match the evidence of evolution with its description: f Comparative Anatomy a. structures that don't…

A: Comparative anatomy - comparin strucrures to show species has shared ancestry. Homologous organ -…

Q: The following DNA sequences were used to generate a contig from a genome sequencing project.…

A: Sequencing is a method for determining an organism's whole genetic make-up. The sequence obtained…

Q: are bacterial cells eukaryatic or prokaryotic?

A: Cell is a microscopic structure exhibited inside the living organisms . It can be one in number or…

Q: TRUE or FALSE? Sexual selection can only occur if the features and/or behaviors associated with it…

A: Natural selection is the interaction through which populaces of living beings adjust and change.…

Q: Can (1) chain and (2) ring structural abberations still lead to fertile gametes? explain

A: Abberations indicates the genetic material which should be DNA . The DNA transfer the information…

Q: What is diabetes mellitus? Differentiate between Type I and type II diabetes

A: Introduction :- A condition in which the body's glucose (a type of sugar) levels are out of control…

Q: A researcher wants to cut this piece of linear DNA. 5'…

A: The restriction enzymes are the specific enzymes that act on the DNA molecule and perform its…

Q: Which types of cell clusters synthesize insulin and glucagon?

A: Insulin and glucagon are the hormones secreted from the mixed gland. Their main function is to…