A) Using this rule, determine the percentages of all the bases in DNA that is 20% thymine. [A] = [C] =_ [G] =. [T] = 20% B) If a single strand of RNA is 20% uracil, what can you predict about the percentages of the remaining bases and why?
Q: Bearing in mind the different number of hydrogen bonds that form between the two different purine-…
A: DNA and RNA are polynucleotides that are composed of a chain of nucleotide monomers with distinct…
Q: If the GC content of a DNA molecule is 60%, what are the molar percentages of the four bases (G, C,…
A: According to the Chargaff rule, the number of Adenines present in DNA is equal to the number of…
Q: Given the sequence shown below, write the complementary DNA sequence, using the base-pairing rules,…
A: DNA (Deoxyribonucleic acid) and RNA (Ribonucleic acid) are two examples of nucleic acids. DNA and…
Q: a) In a DNA double helix, why doesn't an A or T form two hydrogen bonds (out of the three possible)…
A: Since you have asked multiple questions with multiple parts, we will answer only the first three…
Q: The base composition of one of the DNA chains of a DNA double helix contains 18 mol-%A, 35 mol-%T,…
A: Most organisms contain DNA or deoxyribonucleic acid as their genetic material. It is a type of…
Q: What is the rule for the pairing of nitrogen-containing bases in the DNA molecule? And in the RNA?…
A: Deoxyribonucleic acid (DNA) and ribonucleic acid (RNA) are two main nucleic acids (RNA). From…
Q: Which of the following equations are true for double-stranded DNA? a) (%G+%T) =(%A+%C) b) (%G+%A)…
A: DNA stands for deoxyribonucleic acid. It is a genetic material that passes from one generation to…
Q: DRAW A DNA STRAND WITH 10 ADENINE BASES FOLLOWED BY 10 CYTOSINE BASES. IF THAT SAME STRAND BONDED TO…
A: Deoxyribonucleic acid (DNA) is a double helical structure, which is composed of nucleotides. The two…
Q: When proteins recognize and bind to a specific sequence in DNA, why do they usually just recognize…
A: DNA binding proteins are proteins that bind to single or double stranded DNA generally in the major…
Q: To maintain uniform diameter of the DNA double helix, only purines base with each other via two…
A: DNA is the fundamental structure that carries all the information of a living thing. In most cases,…
Q: The double helical structure of DNA is intrinsically unstable and easily dissociates to form two…
A: DNA is deoxyribose and it has a two-strand DNA strand, each stand is made up of a nucleotide that…
Q: Why are there nucleotides (A, T, G, and C) in the master mix? What are the other components of the…
A: PCR is a technique that results in exponential amplification of a selected region of a DNA molecule…
Q: Which of the following relations will be true for the percentage of bases in double-stranded DNA? a.…
A: The deoxyribonucleic acid is the genetic material that is passed from one generation to another…
Q: What two enthalpic factors stabilize DNA in double-helical form at low temperature?
A: The stability of the DNA double helix depends on a fine balance of interactions including hydrogen…
Q: Why is the α-helix so prevalent?
A: The primary structure is formed by the sequence of amino acids forming a polypeptide chain, linked…
Q: f a DNA-binding protein “reads” a short stretch of DNA and detects the following “second” genetic…
A: In DNA, there are four nitrogenous bases namely, Adenine (A), Guanine (G), Thymine (T) and Cytosine…
Q: According to the Watson- Crick model how many polynucleotide chains does a DNA molecule have?
A: The Watson-Crick Model of DNA is a double-stranded, helical molecule. It consists of two…
Q: Provide an explanation for why in DNA, the base G is always base paired with C and A is always base…
A: DNA is a double layered structure. The double helix model is explained by Watson and Crick. The two…
Q: If DNA concentration is 2 grams, what would be the molar concentration of human DNA in a human cell?
A: Introduction: DNA, or deoxyribonucleic acid, is the genetic substance found in humans and virtually…
Q: What entropic factor destabilizes helical DNA at high temperature?
A: The double (ds) stranded DNA undergoes structural changes also known as denaturation at high…
Q: Assuming the genetic code is a triplet, what effect would the addition or loss of two nucleotides…
A: The process in which the messenger ribonucleic acid (mRNA) molecule sequence is translated to form…
Q: Which of the following DNAs is most likely to contain the recognition sequence for a homodimeric DNA…
A: Ans - a.) 5’- G A G C G A T C G C T C - 3’ 3'- C T C G C T A G C G A G -5'…
Q: If a double stranded DNA HAS 20 PERCENT OF CYTOSINE, calculate the percent of adenine of adenine in…
A: According to Chargaff's rule, A = T and G = C, as adenine (A) binds with thymine (T) and guanine (G)…
Q: A closed circular duplex DNA has a 100-bp segment of alternating C and G residues. On transfer to a…
A: B-DNA IS BIOLOGICALLY THE MOST COMMON –RIGHT-HANDED (20 ANGSTROM (A) DIAMETER) –COMPLEMENTARY…
Q: What is the concentration of a DNA solution that absorbs 0.812 and 0.463 at 260 and 280 nm,…
A: Deoxyribonucleic acid (DNA) is the genetic material. It is polymer of nucleotides. The protein…
Q: Insulin is synthesized as preproinsulin, which has 81 amino acids. How many heterocyclic bases must…
A: Insulin is synthesized from preproinsulin. The preprotein is then cleaved by a proteolytic enzyme to…
Q: What is meant by the statement “The genetic code is universal”? What is the significance of this…
A: DNA is deoxyribonucleic acid that contains genetic information. Gene is a segment of DNA that can…
Q: The Tm of a DNA strand can be calculated by hand using the formula: (2 ℃)(?????? ?? ? +…
A: Two standard approximation calculations are used. For sequences less than fourteen nucleotides the…
Q: For double-stranded DNA, which of the following statements is true? a) A = C b) A = G and C = T c) A…
A: For double stranded DNA, According to Chargaff's rules state that DNA from any species of any…
Q: The two strands of a DNA double helix can be separated by heating. If you raise the temperature of a…
A: A double-stranded DNA is joined together by a bond and seems to be a twisted ladder. Which is…
Q: A. In the product, the underlined regions are called what? B. What functional groups are present in…
A: DNA( deoxyribonucleic acid) is the double-stranded molecule that is the genetic material in most…
Q: In a single strand of DNA, is it ever possible for the number of adenines to be greater than the…
A: In a DNA molecule purine always pairs with a pyrimidine base. Adenine is a purine base and thymine…
Q: A duplex DNA oligonucleotide in which one of the strands has the sequence TAATACGACTCACTATAGGG has a…
A: Melting temperature is the point at which 50% of double-helical DNA is changed into a…
Q: The backbone of the DNA molecule is made up of two alternating componebts, what are these? Explain.
A: DNA is considered to be the genetic material within the nucleus that gets packed in thread-like…
Q: State the properties of the Watson-Crick model of DNA in the following categories: a) number of…
A: Molecular Biology is the branch of biology that deals with a study of the composition, arrangement,…
Q: A duplex DNA molecule contains a random sequence of the four nucleotides with equal proportions of…
A: DNA (deoxyribonucleic acid) is a double-stranded molecule and base pairing between two strands is…
Q: The base composition for one of the strands of a DNA double helix is 19% A, 34% C, 28% G, and 19%…
A: Deoxyribonucleic acid(DNA) is a double helix molecule that carries all the genetic instructions of…
Q: For the following sequence of amino acids, serine-valine-lysine-leucine, which of the choices below…
A: Given: a sequence of amino acids, serine-valine-lysine-leucine
Q: . In a supercoiled DNA, a stretch of about 20 base pairs changes from the B form to the Z form. What…
A: DNA is majorly classified into three types as B, A and Z. In B-DNA, there are 10 bases in one…
Q: If the following nucleotide sequence, CTC/TGT/AAG/ACC/TTT experienced a mutation resulting in the…
A: The DNA is transcribed into the RNA by the process of transcription and translation is the process…
Q: Using the concept of complementary base pairing, write the complementary DNA strands, with their 5'…
A: The DNA molecule generally has two strands that wind around one another to form a shape is generally…
Q: If the first strand of DNA is AGCTGCAAT, what would be the nitrogen base sequence of the second…
A: DNA is a biomolecule which contains two strands. Each strand has a backbone composed deoxyribose…
Q: In the Watson-Crick model for the DNA double helix (B form) the A-T and G-C base pairs share all but…
A: DNA and RNA are nucleic acids present in the organisms. DNA is the deoxy ribose nucleic acid whereas…
Q: AAGTCAAGAAGAAGAAGAAGCC A. The nucleotide sequence above is a STR of how many repeats? B. What…
A: Short Tandem Repeats(STR) or microsatellites or simple sequence repeats(SSR) are short sequences of…
Q: Explain, on the basis of nucleotide structure, why DNA synthesis proceeds in the 5’-to-3' direction.
A: The deoxyribonucleic acid (DNA) is known as a double helix structure in which two strands are joined…
Q: In the DNA double-helix structure, the larger of the two grooves formed by the helical twist where…
A: DNA is composed of nucleotides which form its building blocks. Each nucleotide comprises a…
Q: Which would you expect to have a higher entropy: DNA in its wellknown double-helical form, or DNA…
A: The entropy of a system decreases when two single stranded DNA molecules come together and form a…
Learn your way
Includes step-by-step video
Step by step
Solved in 2 steps
- 6. a.) Which part (sugar, phosphate, or nitrogenous base) of the four types of nucleotides differ? b.) Based on the complementary base pairing rules we know that: A(denosine) pairs with _________ , and that G(uanine) pairs with _________.Biochemist Erwin Chargaff was the first to note that, in DNA, [A] = [T] and [G]= [C], equalities now called Chargaff’s rule. Using this rule, determine the percentages of all the bases in DNA that is 20% thymine.Z-DNA derives its name from the zig-zag conformation of phosphate groups. What features of the DNA molecule allow this structure to form?
- pppApCpCpUpApGpApU-OH(a) Using the straight-chain sugar convention, write the structure of the DNA strand that encoded this short stretch of RNA.(b) Using the simplest convention for representing the DNA base sequence, write the structure of the nontemplate DNA strand.1- Biochemist Erwin Chargaff was the first to note that, in DNA, [A] = [T] and [G] = [C], equalities now called Chargaff’s rule. With the use of this rule, determine the percentages of all the bases in a DNA molecule which contains 35% thymine. Explain. 2- Similar equalities (i.e. [A]=[U] and [G]=[C]) are however not observed in RNA molecules. Explain the structural differences which dictate why Chargaff rule does not apply to RNA polynucleotides.To create a DNA:RNA hybrid from a short stretch of DNA with the sequence 5'-GGCTAAGTATGCCTAGTAGC-3', design the corresponding RNA sequence. Indicate the sequence in a 5' to 3' manner. What type of helix (A, B or Z) will this double-stranded nucleic acid form?
- Ethanol (CH3-CH2-OH) is miscible in water because it is able to form hydrogen bonds with itself and other molecules. However, its structure only allows it to form 1-2 hydrogen bonds. This is one reason why even low concentrations of ethanol in solution are lethal for cells. Based on this information, explain why we can use high concentrations of ethanol to precipitate DNA out of solution. Also, describe/predict the effects of increasing concentrations of ethanol in (and around) a cell on macro-molecular interactions (i.e. on weak bonds). Finally, it is possible to select for yeast that are tolerant to increased concentrations of ethanol. Give an example of a physiological change in yeast cells that might make them resistant to ethanol.I'm having difficulty with some homework, 6. a. The double helical structure of DNA is intrinsically unstable and easily dissociates to form two separate strands. Why? How does this affect the two key biological functions of chromosomal DNA? What would happen if the DNA helices were too stable? b. How can one measure the stability of a particular duplex DNA? Which molecular properties affect the stability?The base composition of one of the DNA chains of a DNA double helix contains 18 mol-%A, 35 mol-%T, 26 mol-%C, and 21 mol-%G (a) What is the base composition of the complementary DNA chain? (b) Is the total amount of purine bases equal to the total amount of pyrimidine bases for the DNA double helix?
- Based on Chargaff’s rules, if a segment of DNA is composed of 20% adenine (A) bases, what is the percentage of guanine (G)?As shown, five DnaA boxes are found within the origin of replication in E. coli. Take a look at these five sequences carefully. A. Are the sequences of the five DnaA boxes very similar to each other? (Hint: Remember that DNA is double-stranded; think about these sequences in the forward and reverse directions.) B. What is the most common sequence for a DnaA box? In other words, what is the most common base in the first position, second position, and so on until the ninth position? The most common sequence is called the consensus sequence. C. The E. coli chromosome is about 4.6 million bp long. Based on random chance, is it likely that the consensus sequence for a DnaA box occurs elsewhere in the E. coli chromosome? If so, why aren’t there multiple origins of replication in E. coli?When DNA is heated, it denatures; that is, the strands separate because hydrogen bonds are broken and some base-stacking and hydrophobic interactions are disrupted. The higher the temperature, the larger the number of hydrogen bonds that are broken. After reviewing DNA base pair structure, determine which of the following molecules will denature first as the temperature is raised. Explain your reasoning. a. 5′-GCATTTCGGCGCGTTA-3′ 3′-CGTAAAGCCGCGCAAT-5′ b. 5′-ATTGCGCTTATATGCT-3′ 3′-TAACGCGAATATACGA-5′