Answered: Give the sequence of the complementary…

Science

Biochemistry

Give the sequence of the complementary DNA strand of the DNA chain with the following base sequence: 5'-CTTGGATATC-3'

Biology: The Dynamic Science (MindTap Course List)

4th Edition

ISBN:9781305389892

Author:Peter J. Russell, Paul E. Hertz, Beverly McMillan

Publisher:Peter J. Russell, Paul E. Hertz, Beverly McMillan

Chapter14: Dna Structure And Replication

Section14.3: Dna Replication

Problem 1SB: What is the importance of complementary base pairing to DNA replication?

See similar textbooks

Related questions

Q: Give the base sequence of the complementary DNA strand of the DNA chain with the following base…

A: DNA is a macromolecule composed of individual subunits known as nucleotides. Each nucleotide…

Q: What sequence of bases on one strand of DNA is complementary to the following sequence on another…

A: Complementary bade pairs It is the phenomenon where in DNA Guanine always hydrogen bonds to…

Q: Write the sequence of the complementary DNA strand that pairs with each of the following DNA base…

A: The deoxyribonucleic acid (DNA) is a molecule composed of two polynucleotide chains. It coils around…

Q: Create the complimentary strand for the DNA strand below. Make sure to label the parts and…

A: DNA molecules store genetic material and two primary processes are necessary in order for DNA to…

Q: A template strand in bacterial DNA has the following base sequence: 5′ –AGGTTTAACGTGCAT–3′ What…

A: Bacterial DNA is contained within the bacterial chromosome along with several RNA and protein…

Q: If one strand of DNA has a sequence of TCAG, then the sequence of bases on the complementary strand…

A: DNA is double stranded where the two strands are antiparallel and follows complementary base…

Q: Write the complementary DNA strand for the following DNA base sequence: 5' СТСААG 3' 3' 5'

A: Central dogma consists of replication, transcription and translation. Replication is the synthesis…

Q: Give the corresponding strand of the DNA having the sequence of: a. 5’…

A: DNA(deoxyribonucleic acid) is the heredity material for most living organisms. It is composed of…

Q: Give the sequence of the complementary DNA strand for the DNA chain with the following base sequence…

A: DNA means deoxyribonucleic acid. DNA acts as the genetic material in most of the organisms present…

Q: Two base pairs of double-stranded DNA are shown in the figure. Use your knowledge of base structure,…

A: DNA In DNA there are 4 bases Adenine, Thymine, guanine and cytosine. Adenine binds with Thymine…

Q: Which strand was used to form the following amino acid. strand 3 "ATGGAATGTTTACCCGTATTATACGGATAGACG…

A: The four bases of DNA—the A, C, G, and Ts—are strung together in such a way that the cellular…

Q: H. HD N. A N- H- H. 0=P-0- CH2 H. H. H. OH) H B. Where would this nucleotide hydrogen-bond to its…

A: Each nucleotide is a monomer of nucleic acid such as RNA and DNA. The RNA and DNA differs from each…

Q: One DNA strand has the sequence 5' -ATTCCGTAGC-3' what is the complementary strand sequence?

A: DNA ( Deoxyribonucleic acid ) is two stranded structure which act as genetic material in most of the…

Q: Label the 5' and 3' end of each nucleotide and approximate where the start point (+1) would be on…

A: The process shown here is called transcription. In this process a molecule of mRNA is synthesized…

Q: Describe the double stranded structure of DNA with proper diagram.

A: Introduction : DNA or Deoxy ribonucleic acid is the genetic material which is present in all living…

Q: One strand of a double-helical DNA has the sequence (5’)GCTCAATATTTCTCAAAAT ATTGCGC(3’). Write the…

A: The central dogma of molecular biology is the metabolic process in which the double-helical…

Q: Give

A: Introduction:- The central dogma of biological sciences explains how genetic information is…

Q: A strand of DNA runs the following direction with the following base sequence: 3'-AUG CCC CAG TTA -…

A: Nucleic acids are involved in various processes in the cell, their main role is the expression of…

Q: Match the label on the left with the correct structure number in the DNA molecule in the image…

A: The given structure is of a alpha helix DNA. The DNA is composed of nucleotides. Nucleotide - The…

Q: Write the sequence of the complementary DNA strand thatpairs with each of the following DNA base…

A: A nucleotide is formed by nitrogenous base, sugar and phosphate. Commonly found bases in DNA are:…

Q: Match each DNA component to its corresponding point of attachment. 1. carbon 3' 2. carbon 5' 3.…

A: Deoxyribonucleotide (DNA) is a molecule containing all the genetic information needed to make each…

Q: What type of bond is the arrow pointing to in this image of DNA? -Hydrogen Bond -Covalent Bond…

A: DNA is a molecule that was discovered in the late 1860s by Friedrich Meischer in the nucleus but its…

Q: One strand of a DNA helix has the sequence: 5'-ATTGCCGTC-3'. Write the sequence of its complementary…

A: A DNA helix is an antiparallel helix that is wound on each other. It consists of two complementary…

Q: Write the base sequence and label the 3' and 5' ends of the complementary strand for a segment of…

A: DNA is a duplex helical molecule, which has complementary base pairs. The complementary strands are…

Q: Create the complementary strand for the DNA strand. ATTTGGTT

A: DNA or the Deoxyribonucleic acid present in both eukaryotes and prokaryotes are made up of millions…

Q: Write the sequence of reverse compliment chain to this DNA sequence: CGTCCGCCCCGCGAGCACA…

A: Double stranded nucleic acids are formed through hydrogen bonding between complementary nitrogenous…

Q: 3. 3' CTT TCT TGT AGT TẠC CGG GTA GAA TAG TTG CTG ACT 5'

A: DNA is the genetic material of most living organisms. The DNA is inherited from the parents and it…

Q: Give the sequence of unpaired bases that would be sticky with the following sequences:(a) GGTAC (b)…

A: Restriction endonucleases may cut DNA. The ends of the DNA may be blunt or sticky. A straight cut…

Q: Write the complementary strand to the following single-stranded DNA and label the 5' and 3' ends:…

A: DNA is the molecule found inside cells that carries the genetic data required for an organism's…

Q: For the following DNA sequence: 3’–CGATACGGCTATGCCGGCATT–5’ Write: a) the sequence of the…

A: Deoxyribonucleic acid (DNA) is a molecule with two chains of polynucleotides that wrap around one…

Q: Produce the complimentary DNA strand that would be matched with the provided strand T--A C--G C --G…

A: A complementary strand of DNA is constructed based on base complementarity. Complementarity is…

Q: A strand of DNA contains the base pair 5’-T-C-A-G-C-A-T-3’. Give the base sequence on the…

A: Answer

Q: A nontemplate strand of bacterial DNA has the following base sequence. What amino acid sequence will…

A: During transcription process, the strand used as template is known as template strand which sets in…

Q: A DNA antisense strand contains the following nucleotide base sequence: ATC CAA GAC TGG From this,…

A: DNA refers to deoxyribonucleic acid. It is the genetic material of almost all organisms, except a…

Q: Tabulate the differences of the various DNA conformations in terms of orientation, rise per base…

A: The DNA duples model proposed by Watson and Crick was right handed spiral known as B-DNA. apart from…

Q: Look at the image of the the dinucleotide (two nucleotides joined togethr in a single strand). Base…

A: Nucleotide are the basic building blocks of DNA. A nucleotide consists of a sugar, nitrogenous base…

Q: Show the structure of a DNA where the lead strand is ATCG. Show H-, glycosidic, phosphoester…

A: The form of DNA, known as a double helix, is made up of two connected strands that loop around one…

Q: Draw this stretch of DNA, showing BOTH strands, using a simplified model of a nucleotide as shown:…

A: DNA is the protein in all living organisms that convey genetic information.

Q: What is the term applied to the trinucleotide shown by the arrow? 5' AU Ру AGGCC G C G G G ACCACCUGe…

A: This a structure of tRNA, The tRNA molecule has a distinctive folded structure with three hairpin…

Q: in DNA replication, if the template strand is 5’-ATCCGTGTAACCTT-3’, what is the sequence of the…

A: DNA strand is made up of 4 nitrogenous bases i.e adanine, thymine, guanine & cytosine.

Q: Write the base sequence in a complementary DNA segment if each original segment has the following…

A: The cell is the basic primary unit of life for all living organisms. Inside this, the nucleus is the…

Q: Using the DNA figure below to identify structures of the following letters: A= B= C= D= E= F: Circle…

Q: Describe the way in which DNA is folded. give at least 5 points

A: DNA or deoxyribonucleic acid is a biomacromolecule molecule that stores genetic information in most…

Q: Indicate the correct base order for the complementary DNA strand by placing the correct label in…

A: A DNA strand is formed of nitrogenous bases also called nucleobases. There are 4 nucleobases viz.…

Q: If one strand of DNA has the sequence 5'-C-T-A-G-C-G-T-T-A-3', what sequence would appear opposite…

A: DNA is the genetic material that involves the transfer of information from one generation to the…

Q: Fill in the palindromic sequence of the given DNA strand containing six bases.

A: A palindromic DNA sequence is a sequence made of nucleic acids with double helix of DNA /RNA that…

Q: Create the RNA strand to be synthesized from the DNA double strand below and explain this synthesis,…

A: DNA are double helical structures that contains genetic information, which is responsible for almost…

Q: Fill in the blank with the most appropriate term that is described by the following statement:…

A: The components of DNA replication. A five-membered, oxygen-containing ribose sugar ring with three…

Q: Create the RNA strand to be synthesized from the DNA double strand below and explain this synthesis,…

A: Transcription of DNA into mRNA and translation of mRNA into protein is known as the central dogma of…

Question

34. Answer and explain

Give the sequence of the complementary DNA strand of the DNA chain with the following base sequence:
5'-CTTGGATATC-3'

Expert Solution

This question has been solved!

Explore an expertly crafted, step-by-step solution for a thorough understanding of key concepts.

SEE SOLUTION Check out a sample Q&A here

Step 1

VIEW

Step 2

VIEW

Step by step

Solved in 2 steps

SEE SOLUTION Check out a sample Q&A here

Similar questions

What are the base-pairing rules for DNA? a. A-G, T-C c. A-T, G-C b. A-C, T-G d. A-A, G-G, C-C, T-T
Make the complementary strand for the following DNA template and label both strands as 5 to 3 or 3 to 5 (P = phosphate in the diagram). Draw an arrow showing the direction of synthesis of the new strand. How many hydrogen bonds are in this double strand of DNA? template: PAGGCTCGOH new strand:
How many kilobases of the DNA strand below will code for the protein product?
State the properties of the WatsonCrick model of DNA in the following categories: a. number of polynucleotide chains b. polarity (running in same direction or opposite directions) c. bases on interior or exterior of molecule d. sugar/phosphate on interior or exterior of molecule e. which bases pair with which f. right- or left-handed helix
Using Figures 8.7 and 8.9 as a guide, draw a dinucleotide composed of C and A. Next to this, draw the complementary dinucleotide in an antiparallel fashion. Connect the dinucleotides with the appropriate hydrogen bonds. FIGURE 8.9 The two polynucleotide chains in DNA run in opposite directions. The left strand runs 5 to 3, and the right strand runs 3 to 5. The base sequences in each strand are complementary. An A in one strand pairs with a T in the other strand, and a C in one strand is paired with a G in the opposite strand. FIGURE 8.7 Nucleotides can be joined together to form chains caled polynucleotides. Polynucleotides are polar molecules with a 5 end (at the phosphate group) and a 3 end (at the sugar group). An RNA polynucleotide is shown at the left, and a DNA polynucleotide is shown at the right.
List the pyrimidine bases, the purine bases, and the base-pairing rules for DNA.
DNA contains many hydrogen bonds. Are hydrogen bonds stronger or weaker than covalent bonds? What are the consequences of this difference in strength?
RNA is ribonucleic acid, and DNA is deoxyribonucleic acid. What exactly is deoxygenated about DNA?
What is the importance of complementary base pairing to DNA replication?
Translate the .sequence of bases in the previous question, starting at the second base.
Energy that drives the attachment of a nucleotide to the end of a growing strand of DNA comes from ________. a. the nucleotide b. DNA polymerase c. phosphate-group transfers from ATP
Chemical analysis shows that a nucleic acid sample contains A, U, C, and G. Is this DNA or RNA? Why?