Q: Answer both part (a) and part (b), illustrating your answer with reference to specific named…
A: Pathogens are the organisms or microorganisms which infect the animals or plants. They can be either…
Q: write 5 Neurological tests of the spine,5 tests for the spinal joints and 5 special tests of the…
A: A neurological exam, sometimes known as a neuro exam, is a test that evaluates a person's nervous…
Q: 1. What is the significance of soaking the container in bleach? 2. What is the significance of…
A: Significance of container soaking in bleach before pouring :-
Q: Describe and differentiate the thorax of the ox from that of the thorax of the horse and the pig.…
A: Thorax is described as the region that lies between the neck in a superior manner and the abdomen…
Q: Is each of the following haploid, diploid, or dikaryotic: basidiocarp, basidiospore, primary…
A: Each cell have the nucleus, and in the nucleus, they have chromosomes in different sets in different…
Q: 7. Classes under Phylum Annelida(3) 8. Classes under Phylum Mollusca(5) 9. Classes under Phylum…
A: Solution -ANS 7-annelids as having three major classes: Polychaeta, Oligochaeta, and Hirudinea.ANS…
Q: 1. Name the molecule that contributes to the shape of a capsid around a virus?
A: The capsid is basically a protective layer around the viral structure which usually protects the…
Q: In a community based project, how does the use of Walnut Shells and Sappan Woods as Eco-Friendly Ink…
A: INTRODUCTION Material that has been recycled, material that is readily recycled, or material…
Q: I need the answer as soon as possible
A: Plants work as factories for carbohydrate production. Carbon Dioxide is generated by the cells of…
Q: the four major mechanisms of antibiotic resistance and explain it
A: Antibiotics disrupt essential structures or processes in bacteria. This in turn either kills the…
Q: There are usually ethical concerns when the topic of biotechnology is discussed. The use of…
A: Ethical concerns related to human tissue use in research.
Q: Which is the odd man out based on the third appendage? Asiomorpha, Tachypleus, Menalaides, or…
A: An appendage (or outgrowth) is an external body part, or natural prolongation, that protrudes from…
Q: Explain the roles of mRNA and tRNA during the synthesis of proteins. In your answer explain how the…
A: The translation is the process that involves production of polypeptide chain or protein from the…
Q: Which enzyme can recognize an altered base in the DNA? Group of answer choices DNA Polymerase AP…
A: There are several DNA repair mechanisms are present that are- direct repair system, excision repair…
Q: Describe stages for the extravasation of neutrophils during inflammation. Include in your…
A: Introduction Immunity: it is the property/capability of our system to fight against the harmful…
Q: Each enzyme is able to promote only one type of chemical reaction. The compounds on which the enzyme…
A: Enzymes are the proteinaceous molecules which when added to reaction enhances the activity .…
Q: Humans are beginning to fragment populations more and more: which population structure is most…
A: Habitat fragmentation describes the emergence of discontinuities (fragmentation) in an organism's…
Q: Describe Class I MHC pathway of antigen processing and presentation. Highlight the functions of the…
A: The immune system is made up of a variety of cells as well as tissues that are distributed…
Q: 1. Explain how pareto analysis and control charts each help organizations in problem solving and…
A: 1. Pareto analysis is simple decision-making technique for assessing competing problems and…
Q: The ascomycete life cycle typically includes (a) mainly diploid thalli (b) the formation of a thick…
A: Introduction :- Ascomycota are septate fungi with filaments divided by septa, which are cellular…
Q: An increase in the reabsorption of solutes will decrease water reabsorption. True False
A: ANSWER;- True
Q: Metabolism/processing of macronutrient fuels to generate ATP requires all of the following except:…
A: Metabolism It is defined as the process through which the food is converted into energy in our body.…
Q: Splicing machinery must recognize three portions of the precursor RNA molecule: the 5’ splice site,…
A: The spliceosome, a huge ribonucleprotein complex, is responsible for removing introns from…
Q: According to Charles Darwin, organic evolution is "descent with modification," which simply means…
A: Charles Darwin, a British naturalist proposed the theory of organic evolution by natural selection.…
Q: why do gray squirrels prefer crushed walnuts than walnuts with shells?
A: Normal squirrels have four front teeth that never stop growing and make it easy for them to eat…
Q: What does pulse oximetry have to do with PaCO2? а. A pulse oximeter can directly measure the PaCO2…
A: Introduction :- Pulse oximetry is a noninvasive way to check someone's oxygen saturation. The more…
Q: What do you think are some best practices to control viral diseases in Aquaculture systems? Explain…
A: Aquaculture is the fastest growing food-producing sector globally and, with intensification of the…
Q: Which of the following structures are associated with the ends of chromosomes and may shorten over…
A: Chromosomes are thread like structure made of a single molecule of DNA associated with proteins.…
Q: Which of the following statements concerning the evolution of behavior is correct? A. Natural…
A: Behavioral evolution can include sensory system alterations, brain changes, and even physical…
Q: Compare the structure and roles of the lymph node and the spleen in the immune system.
A:
Q: How does oviposition occurs in female frugs. Provide the pathway involved in the oviposition process
A: The female reproductive system consists of ovaries and oviducts. A pair of ovaries located near the…
Q: Cells were incubated with chloroquine for 2 hours before stimulation with lipopolysaccharide (LPS,…
A: Tumor necrosis factor (TNF) is a multifunctional cytokine that plays important roles in diverse…
Q: Are AS heterozygotes completely resistant to malarialinfection? Explain the evidence for your…
A: Malaria is a parasitic disease spread by mosquitoes. Humans are infected with the parasite after…
Q: Other than obvious changes in protein-encoding Neanderthal genes, changes in what type of non-coding…
A: Small tandem repeats (STRs) are short repeating DNA sequences (2–6 bp) that contribute for about 3%…
Q: Using the given information, determine the correct order of the following events during translation:
A:
Q: How the evolution of oxygen was involved in the initial evolution of terrestrial life
A: Photolysis of water vapors and carbon dioxide produce hydroxyl and oxygen, individually, thus, they…
Q: DNA: | CAT AGG GAG | CAA GGG TGA CTT TTT | AAT AAT GAC GGG|| MRNA: amino acids:
A: As per our company guideline we are supposed to answer only first queation . So kindly repost other…
Q: give an example and explanation of how niche differences related to diet are manifest in differences…
A: Niche: The biological niche is the sum total of all the ecological requisites and activities of…
Q: 1. The pointed layer of the skin... a. Is located below the stratum germinativum b. Consists of…
A: skin is made of two main layers Epidermis and under it Dermis Epidermis has further 5 layers from…
Q: Two tandem repeats have tested positive for a murder suspect. To determine the probability of any…
A: Tandem repeats is repeatition for multiple time of short length gene in a DNA sequence also called…
Q: Questions: 1. Length of fur is also genetically determined. The allele L produces long fur and its…
A: The alleles are the alternative forms of a gene that are located on the same locus of a homologous…
Q: Why is classifying mammals by feeding habits not particularly useful to phylogenetic studies
A: Phylogenetics is the study of the developmental or evolutionary relatedness among the group of…
Q: How many sets of human chromosomes are in each of the following cell types? a. an oogonium b. a…
A: The haploid (n) number of chromosome in an organism is known as a single chromosome set. As humans…
Q: Question 34 The diarrhea (loose and watery stool) that is a symptom of diseases like cholera is due…
A: Gallbladder is basically associated with digestive system and helpful in storing the bile juice…
Q: Match the concept in column A to the concept in column B. Write the letter of the correct answer on…
A: Ans: Amino acids are C - terminus and N -terminus. 2. In endoplasmic reticulum, attachment of…
Q: Echinodermata d. Pandak py Chordata e. echidna Meristics amphibians reptiles f. Architeuthis g.…
A: Coelenterates are also known as cnidaria. These are diploblastic organism, having tissue grade…
Q: Describe the distinguishing characteristics of fungi.
A: Introduction Fungi are unique species characterised by their own biological kingdom, which means…
Q: (1) A plant cell may burst when: (A) Turgor pressure equalises wall pressure. (B) Turgor pressure…
A: Introduction - Plant cells are eukaryotic, meaning that they have their own nucleus. Plant cells are…
Q: ile other photons of visible light are reflected. Explain what is happening in a ment molecule at…
A: The band of colour in the sunlight which is visible is included in the visible spectrum. It is…
Q: Match the receptors in column A with the stimulus it perceives la column B and the type of receptor…
A: Types of receptors - Chemoreceptor Thermoreceptor Mechanoreceptor Photoreceptor
Give the protein synthesized of the given mRNA sequence. No need to explain. Just give the answer.
ACUGAAAUGACCAGAUUUAUGGCCUGAAUGACC
Step by step
Solved in 2 steps
- If my final mRNA product sequence is this: CAAGAUGUACUUUGCGACAAGAGAGGAUCCCAUCUGUGCGACUUGAACG What would the final protein product be? (only use the capitalized letters).Given below is the mRNA sequence that encodes the amino acids of a protein. Based on the mRNA sequence predict the amino acid sequence that it encodes. Please list the protein sequence as SINGLE letter amino acids.mRNA: -AUGACACCACUCCACUUAUAGCCCUAA-Please help me find the protein sequence in reference to the text below. "mRNA Sequence Translate the mRNA sequence of HbS. 5'-AUG GUG CAC CUG ACU CCU GUG GAG AAG UCU GCC GUU ACU - 3¹ Protein Sequence 5'-"
- Write down the corresponding amino acids sequence for each mRNA sequence. Use the codon chart.Translate the mRNA into a protein using the genetic code. (Amino acid chain.) AUG( met)-UUU( Phe)-GUA( Val) - CAU (his)-UUG(leu) -UGU(cys)- GGG(gly)- AGU(ser)- CAC (his) - CUG(leu) GUU(Val)- GAG (Glu)-GCG(ala)- UUG(Leu)- UAU(tyr)- UUG (leu)-GUU(Val)- UGU(cys)- GGC(gly)-GAG( Glu)-CGC(arg) - GGC(gly) - UUU(phe) - UUC(phe).The amino acids, in one-letter symbols and no spaces, coded by the following mRNA sequence is 5’ AAUGGAACGUCGGUACUGCCAUCGCAUUAGUACCAUGGCAAGCUGAAGC 3’
- draw mRNA sequence for the following sequence ATGGCCCTGTGGATGCGCCTCCTGCCCCTGCTGGCGCTGCTGGCCCTCTGGGGACCTGACCCAGCCGCAGCCTTTGTGAACCAACACCTGTGCGGCTCACACCTGGTGGAAGCTCTCTACCTAGTGTGCGGGGAACGAGGCTTCTTCTACACACCCAAGACCCGCCGGGAGGCAGAGGACCTGCAGGTGGGGCAGGTGGAGCTGGGCGGGGGCCCTGGTGCAGGCAGCCTGCAGCCCTTGGCCCTGGAGGGGTCCCTGCAGAAGCGTGGCATTGTGGAACAATGCTGTACCAGCATCTGCTCCCTCTACCAGCTGGAGAACTACTGCAACTAGUsing the mRNA sequence you made, translate this into a protein sequence. Begin translation at the first AUG (start codon) in the sequence, starting from the mRNA 5’ end. When writing the amino acids that are found in the protein, you may use the single-letter code, three-letter code, or full amino acid names.If the DNA sequence is 3’ ATCGACGTC 5’, what is the mRNA sequence