What is the sequence of the newly synthesize DNA segment if the template strand has the following sequence: 3'-ATGGCCTATGCGAT-5'

Q: The following sequence of nucleotides is found in a single-stranded DNA…

A: DNA is the double-stranded molecule that is the genetic material in most animals except for some…

Q: Give the base sequence of the complementary DNA strand of the DNA chain with the following base…

A: DNA is a macromolecule composed of individual subunits known as nucleotides. Each nucleotide…

Q: If this is the original sequençe of a DNA strand: CCAGGTCCATGACTTAGC, how would you labeled the one…

A: It is an alteration in the nucleotide sequence of the genome of an organism.

Q: Base on the coding strand of DNA: ATG GGA ATT CGC What is the sequence of the complementary…

A: DNA or DeoxyRiboNucleic Acid is a biomolecule which serves as a genetic material in number of…

Q: A template strand in bacterial DNA has the following base sequence: 5′ –AGGTTTAACGTGCAT–3′ What…

A: Bacterial DNA is contained within the bacterial chromosome along with several RNA and protein…

Q: Identify the template and non-template strand on the DNA. B TACGGATACG UACGGAUA ATGCCTATGC

A:

Q: ou are given a segment of DNA : 5’  - CATGTCAAC – 3’    What is the complimentary strand?

A: Adenine in DNA always pairs with Thymine and cytosine always pairs with Guanine and vice versa .…

Q: If the sequence of a gene is: 3'TACATACCAACTGAGGATCGC5' 5'ATGTATGGTTGACTCCTAGCG3' And the RNA…

A: DNA is a double stranded helical structure found generally in Eukaryotes and prokaryotes while in…

Q: Which of the three Mut proteins isresponsible for ensuring that the mismatched basein the newly made…

A: Mismatch repair or MMR is the system that recognizes and repairs any misincorporated, deleted, and…

Q: What sequence of bases on one strand of DNA (reading in the 3′ to 5′ direction) is complementary to…

A: DNA (Deoxyribonucleic Acid) It is defined as a genetic material that has all the stored genetic…

Q: One DNA strand has the sequence  5' -ATTCCGTAGC-3' what is the complementary strand sequence?

A: DNA ( Deoxyribonucleic acid ) is two stranded structure which act as genetic material in most of the…

Q: Label the 5'  and 3' end of each nucleotide and approximate where the start point (+1) would be on…

A: The process shown here is called transcription.  In this process a molecule of mRNA is synthesized…

Q: Give the sequence of the complementary DNA strand for the DNA chain with the following base sequence…

A: Biomolecules are organic molecules made up of mainly carbon and hydrogen but there are other…

Q: For the following sequence, transcribe and translate the sequence into a protein. Be sure to…

A: Given strand is DNA template strand- 3'-TACCACCCCCTGAGTGCTGGGATC-5' Transcription of template Strand…

Q: Which of the following would be the correct complementary sequence to this strand of DNA: 5 ATTCGATC…

A: Question- Which of the following would be the correct complementary sequence to the strand of DNA…

Q: The sequence below shows a mRNA sequence derived from a template strand of a DNA molecule: DNA…

A: DNA undergoes replication to form 2 DNA molecules (one parental strand and one new strand) and then…

Q: One strand of a double-helical DNA has the sequence (5’)GCTCAATATTTCTCAAAAT ATTGCGC(3’). Write the…

A: The central dogma of molecular biology is the metabolic process in which the double-helical…

Q: RNA is transcribed. Label the 5′ and 3′ ends of each strand. 17. The following sequence of…

A: During the process of transcription. RNA polymerase is the enzyme and its main function is to…

Q: For the following DNA sequence: 3’–CGATACGGCTATGCCGGCATT–5’ Write: b) the sequence of the…

A: The given DNA sequence is as follows 3’–CGATACGGCTATGCCGGCATT–5' The above given strand is a…

Q: You have determined that the newly synthesized strand of DNA in your sequencing reaction has the…

A: Template Strand will be: 3' TGATGGCTCA5'

Q: Given the double-stranded DNA molecule shown below, what is the sequence of the MRNA corresponding…

A: Given information: Coding strand 5' TATGAAATTTAAATTT 3' Template strand 5' ATACTTTAAATTTAAA 3'

Q: Draw the double-stranded sequence of each fragment after cleavage showing any phosphates left on the…

A: Restriction endonucleases cut double stranded DNA at specific site or near specific site and form…

Q: DNA pol III synthesizes the leading strand as a continuous strand. The lagging strands are…

A: DNA, deoxyribonucleic acid is a double helical molecule present in the cell which carries genetic…

Q: Original ONA Strand A-C-C-G T-A-C T-G-G-AA-T-G Complementary DNA Strand What is the most likely…

A: DNA Replication is the synthesis of new daughter DNA strands complementary to the template DNA…

Q: For a double stranded coding region DNA transcribed from left to right and whose top strand is…

A: There are two strands of DNA. One strand goes from 5' to 3' and the other strand goes from 3' to 5'.…

Q: A non-coding DNA strand has the sequence below: GTACCGATATAATCGGGCTA What is the MRNA sequence that…

A: Noncoding DNA sequences are DNA sequences that do not encode protein sequences in an organism.…

Q: One strand of a DNA helix has the sequence: 5'-ATTGCCGTC-3'. Write the sequence of its complementary…

A: A DNA helix is an antiparallel helix that is wound on each other. It consists of two complementary…

Q: In which region(s) will Okazaki fragments be found during new strand synthesis? (see image for…

A: Semi replicative mechanism is a type of DNA mechanism which explained the type of replication…

Q: The following sequence of nucleotides is found in a single-stranded DNA template:…

A: Transcription is a process through which the template strand of DNA transcribes into mRNA to carry…

Q: Write the complementary strand to the following single-stranded DNA and label the 5' and 3' ends:…

A: DNA is the molecule found inside cells that carries the genetic data required for an organism's…

Q: A lagging strand is sketched below. The Okazaki fragment DNA is red, and the RNA primers are dashed…

A: Introduction: DNA stands for 'deoxyribonucleic acid' and it is the hereditary material in humans and…

Q: Question mentioned in the attachment

A: B form of DNA is considered a right-handed double helix DNA. It tends to runs in opposite directions…

Q: All transposons would have these components among A- D EXC A) O transposase B) O insertion sequences…

A: Transposable elements are those DNA sequences that move from one location on the genome to…

Q: Which of the following single-stranded DNA sequences is most likely to form a stem-loop structure?…

A: Double-stranded DNA consists of two polynucleotide chains each strand having a phosphodiester…

Q: In the DNA segment 5'-ATGAGGCATGAGACG-3' (coding strand) 3'-TACTCCGTACTCTGC-5' (template strand)…

A: A DNA segment is generally a genomic feature recognized by anonymous DNA probes. Symbols for such…

Q: Write down the double stranding sequence of the resulting DNA fragment(s) if the following DNA…

A: They enhance the rate of a reaction without being consumed or modified during the reaction.…

Q: Which of the following pairs of base sequences could form ashort stretch of a normal double helix of…

A: Deoxyribonucleic acid (DNA) is the hereditary material present in humans and almost all organisms.…

Q: What will be the sequence of the single-stranded RNA transcribed from the following segment of…

A: Answer: TRANSCRIPTION : It is the process in central dogma in which single stranded RNA is formed…

Q: Given the template DNA strand 3’-TACCCTCAAGGGCAAACT-5’, provide the complimentary DNA strand, mRNA,…

A: DNA is the genetic material of almost all living organisms. The DNA is inherited from the parents…

Q: The sequence of the template strand if a nontemplate strand has the sequence 5 ATGGGGCGC3

A: The coding strand determines the correct nucleotide sequence of mRNA. The template strand acts as a…

Q: What is the melting temp. of the following double-stranded DNA fragment…

A: Melting temperature of the DNA is the temperature at which half of the DNA becomes single stranded…

Q: list the RNA sequence transcribed from the DNA template sequence TTACACTTGCTTGAGAGTC

A: DNA is a double-stranded molecule that stores the genetic information in the form nucleotide…

Q: Give the mRNA and amino acid sequence from this DNA strand: CCATTAACCTTACTGCTGGCTAAATTCGTTGCT

A: DNA => Transcription => mRNA => Translation => Protein Given a sequence of DNA:…

Q: How does the double helix structure of DNA support role encoding the genome

A: DNA is the short form of deoxyribonucleic acid. It is the molecule that contains the genetic code of…

Q: Evaluate the mutation below. Original DNA strand: 3'-TACTTACGCACGGCCACT-5' Amino acids produced:…

A: From the DNA sequence the mRNA is produced within the nucleus of the cell by the transcription…

Q: #1:  3’   T   A  C   A   T   G   C   C   G   A   A   T   G   C   C   5’      #2:  3'   T  A   C   T…

A: The mRNA is produced from the DNA by the process of transcription and proteins are produced from the…

Q: Here is the sequence of a portion of one strand of DNA: 5'-GTCCTAACGACTGATCGT-3' a. What is the…

A: According to the central DNA is converted to RNA (transcription) and RNA to protein (translation).…

Q: In the sequences below, which is the coding strand and which is the template strand? A. 5-…

A: The strand of DNA which serves as the template for the mRNA synthesis during transcription is called…

Q: What size DNA fragment would be released after very mild digestion of chromatin with micrococcal…

A: Introduction  Micrococcal nuclease in as example of endo-exonuclease which is obtained from…

Gene Interactions

When the expression of a single trait is influenced by two or more different non-allelic genes, it is termed as genetic interaction. According to Mendel's law of inheritance, each gene functions in its own way and does not depend on the function of another gene, i.e., a single gene controls each of seven characteristics considered, but the complex contribution of many different genes determine many traits of an organism.

Gene Expression

Gene expression is a process by which the instructions present in deoxyribonucleic acid (DNA) are converted into useful molecules such as proteins, and functional messenger ribonucleic (mRNA) molecules in the case of non-protein-coding genes.