Using the coding strand of a DNA molecule below, what will the first 6 bases of the template strand be? 5’ ATAGATGAAGCCCCACGCCTA 3’ (coding strand of DNA) 3’ 5’ (template strand or non-coding strand of DNA) 5’ 3’ (mRNA strand) a. UAUCUA b. GCGAGT c. TATCTA

Using the coding strand of a DNA molecule below, what will the first 6 bases of the template strand be? 5’ ATAGATGAAGCCCCACGCCTA 3’ (coding strand of DNA) 3’ 5’ (template strand or non-coding strand of DNA) 5’ 3’ (mRNA strand) a. UAUCUA b. GCGAGT c. TATCTA

Name: Using the coding strand of a DNA molecule below, what will the first 6
Uploaded: 2024-03-20T06:42:41.000Z
Channel: Bartleby
Description: Using the coding strand of a DNA molecule below, what will the first 6 bases of the template strand be?5’ ATAGATGAAGCCCCACGCCTA 3’ (coding strand of DNA)3’ 5’ (template strand or non-coding strand of

Human Heredity: Principles and Issues (MindTap Course List)

11th Edition

ISBN:9781305251052

Author:Michael Cummings

Publisher:Michael Cummings

Chapter8: The Structure, Replication, And Chromosomal Organization Of Dna

Section: Chapter Questions

Problem 22QP: Make the complementary strand for the following DNA template and label both strands as 5 to 3 or 3...

See similar textbooks

Similar questions

Match the terms appropriately. ___ nucleotide ___ clone a. nitrogen-containing base, sugar, phosphate groups ___ autosome b. copy of an organism ___ DNA polymerase c. does not determine sex ___ mutation d. injects DNA ___ bacteriophage e. replication enzyme ___ semiconservative replication f. can cause cancer g. something old, something new ___ DNA ligase h. seals gaps and breaks
Make the complementary strand for the following DNA template and label both strands as 5 to 3 or 3 to 5 (P = phosphate in the diagram). Draw an arrow showing the direction of synthesis of the new strand. How many hydrogen bonds are in this double strand of DNA? template: PAGGCTCGOH new strand:
What would be the complementary strand of DNA below? 3’-ACGTGCTACGGTACG-5’
f the template strand of DNA has the sequence 5’-TCTAGGACT-3’, what will the sequence of the transcribed RNA be? A. 5’-AGAUCCUGA-3’ B. 5’-UCAGGAUCU-3’ C. 5’-AGUCCUAGA-3’ D. 5’-AGATCCTGA-3’ E. 5’-UCAGGATCT-3’
If the sequence of one strand of DNA is 3’ ATTAGCA 5’, then the sequence of its sister DNA strand would be (a) 5’ TAATCGT 3’ (b) 3’ ACGATTA 5’ (c) 3’ TAATCGT 5’ (d) 5’ UAAUCGU3’ (e) None of the above
A primer is laid down complementary to the DNA sequence TAGCAATCGCA to prime synthesis of a daughter strand. What will the sequence of the primer be? A. ATCGTTAGCGT B. ATGGTTAGGGT C. AUCGUUAGCGU D. AUCGTUAGCGT
What would be the sequence that the RNA polymerase synthese from the follwing DNA sequence? 5' ACCTCATTGCTAC 3' 3' TGGAGTAACGATG 5'
The template strand of DNA is 3’AGGATGCACGTAC5’ The sequence of the mRNA that is made from this DNA is: A) 5’UCCUACGUGCAUG3’ B) 5'AGGATGCACGTAC 3’ C) 3’UCCUACGUGCAUG5’ D) 3’AGGAUGCACGUAC5’ E) 5’AGGAUGCACGUAC3’
What is the sequence of the DNA template strand from which each of the following mRNA strands was synthesized? a. 5 '–UGGGGCAUU–3 ' c. 5 '–CCGACGAUG–3 'b. 5 '–GUACCU–3 ' d. 5 '–GUAGUCACG–3 '
. How does the double helix structure of DNA support itsrole in encoding the genome?a. The sugar-phosphate backbone provides a templatefor DNA replication.b. tRNA pairing with the template strand createsproteins encoded by the genome.c. Complementary base pairing creates a very stablestructure.d. Complementary base pairing allows for easyediting of both strands of DNA.
Shown below is a DNA coding strand. A base (*G*) mutates to Adenine (A). What will be the resulting amino acid sequence as a result of the mutation? What type of mutation occured? Hint: Determine the template, then first determine the amino acid sequence before the mutation, and then determine the amino acid sequence after the mutation. Show how you got your answer. 5' T-A-C-T-T-C-C-A-*G*-C-C-G-C-T-C 3'
For each DNA segment: [1] What is the sequence of the mRNA molecule synthesized from each DNA template? [2] What is the sequence of the informational strand of the DNA molecule? a. 3 '–TGCCTAACG–5 ' c. 3 '–TTAACGCGA–5 'b. 3 '–GACTCC–5 ' d. 3 '–CAGTGACCGTAC–5 '