Given Tagatose, Briefly explain its expected reaction (based on their structural formula) to the different qualitative tests for carbohydrates which are: (a)Barfoed’s test (b)Seliwanoff’s test (c) Iodine’s test
Q: Competitive inhibitors are: Select one: O a. bind to another part b. causing the enzyme t bind to…
A: Inhibitors are molecules that bind to enzyme and block it's activity. Enzymes inhibitors are…
Q: *Which of the following statements about allosteric enzymes is NOT true? Question 10 options: - They…
A: Allosteric enzymes have binding sites other than active sites for the regulator molecules that…
Q: 10. The degree of unsaturation of lipid can be measured as A. saponification number B. iodine number…
A: Saturated fats are the fatty acids in which the hydrocarbon chain with a carboxyl group contains…
Q: -Inhibitor +Inhibitor [S] (mM) V&ν βσπ:(μmol/sec) ν0&νβσπ: &νβσπ: (μmol/sec) 0.0001 33 17 0.0005 71…
A: Inhibitors are the substances that bind with enzyme and alter the km and Vmax values. Depending on…
Q: a. list the proteins in the order of first to the last that eluted 6. list the proteins in the order…
A: Proteins are composed of amino acids with specific molecular weight and pI (isoelectric point).…
Q: Maintaining blood glucose levels above 40 mg/dL is important so that all cells are able to take in…
A: Glycogen is a polymer with a branching structure. Carbohydrates are stored in this form in the human…
Q: Given Ribose, Briefly explain its expected reaction (based on their structural formula) to the…
A: Ribose is a pentose sugar. It is an alose. The structure of ribose is given below: Qualitative…
Q: All of the following are standard tests used in diagnosing diabetes EXCEPT O Glycated hemoglobin…
A: Diabetics is disease in which blood glucose level in increase more than 126mg/dL.In diabetics…
Q: ruvate through the TCA cycle. calculate the net ATPS produced from one olecule of alucose in a…
A: Oxidation of glucose molecule through a combined action of glycolysis , the TCA cycle , and…
Q: *Which of the following statements about allosteric enzymes is NOT true? Question 10 options: - They…
A: Enzymes are biocatalysts that increase the rate of a reaction by a factor of several. Living cells…
Q: When comparing two or more ligands, a larger numerical value for KD corresponds to a higher binding…
A: “Since you have asked multiple question, we will solve the first question for you. If youwant any…
Q: Enumerate the main structural features of nucleosides and nucleotides
A: There are 4 biomacromolecules; protein, carbohydrate, lipid and nucleic acids. In these, nucleic…
Q: All these enzymes hydrolyze disaccharides in the small intestines EXCEPT maltase sucrase…
A: Disaccharides are substances that are made up of two molecules of simple sugars linked together.…
Q: A newly developed qPCR has an efficiency of 75%, and each cycle is pretty consistent. In this qPCR,…
A: In general, qPCR is beneficial for determining the actual value of a PCR product present at a given…
Q: Derivatives of purines and pyrimidines make up the base component of nucleotides. Select the…
A: Purines and pyrimidines are nitrogenous bases that makeup two types of nucleotide bases in DNA and…
Q: 3. Identify if the following is a pyrimidine/purine nucleotide or a pyrimidine/purine nucleoside and…
A: Hi, Thankyou for posting your question on Bartleby. As per the guidelines we are allowed to answer…
Q: 7. What is the base sequence, specified in the 5' to 3' direction, for a segment of newly formed DNA…
A: The genetic material in most organism is double stranded DNA with the two strands running in…
Q: CH3 CH3 CH3(CH2)n: O sterol O Cholesterol O Lysophosphatidylcholine O Cholesteryl ester
A: Sterols are important sub groups of steroids that contain OH at 3rd position of A ring of structure.…
Q: These are enzymes that can sustain in a high hydrostatic pressure. * (Please choose one correct…
A: Bacteria are classified into different classes based on the influence of different environmental…
Q: 2. An MRNA has a sequence AAAUUACUCGAAAUUGCGUGUAGUS'. DNA, t-RNA and amino acid sequence of the…
A: Given mRNA from 5' to 3' direction: UGAUGUGCGUUAAAGCUCAUUAAA
Q: Gluconeogenesis in the liver is When blood glucose levels are low, glucagon is secreted from the…
A: Blood is defined as the type of constant circulating fluid that play a major role in carrying…
Q: Question 3 -- / 1 What form(s) of chemical energy are generated during cyclic photo-phosphorylation?…
A: Introduction: Photophosphorylation is the process by which photosynthetic organisms use the energy…
Q: Calculate the actual free energy of hydrolysis of ATP, delta Gp in the erythrocytes of a new…
A: Actual free energy (∆G) is the maximum amount of energy which is available to perform work. Standard…
Q: 1. Of which of these do your cells have the least of? A. MRNA B. FRNA C. TRNA D. NDNA E. Proteins 2.…
A: Cells are composed of different components, cell organelles and molecules that are responsible for…
Q: I want a solution that is 1/10th the strength of my stock solution. I want 20 microliters of total…
A: A solution can be diluted to the desired concentration by using the formula C1V1=C2V2 Where C1=…
Q: I. Identify the reactants, enzymes, cofactors/coenzymes and products involved in the glycolysis…
A: The breakdown of glucose to obtain energy is the routine pathway of cells for fulfilling their…
Q: Principle involved in the isolation of gluten * (Please choose one correct answer only) A.…
A: The protein component of wheat flour is called Gluten. This basic component gives elasticity and…
Q: Explain the biochemical consequences of ADA deficiency and explain them using the purine degradation…
A: The purine nucleotides are sequentially degraded by the removal of portions of nucleotides. The…
Q: mixture of Alanine (pl 6.02), Glutamic Acid (pl 3.22), Glycine (pl 5.79), Lysine (pl 9.74) and…
A: As anion resin is positively charged, it attracts amino acids that have a negative charge. Proteins…
Q: 2) a. Give the name of the following glycoside: но. он но но b. Draw the structure of the…
A: In the question 2a, the compound has D-mannose sugar linked to a phenyl ring with O-glycosidic bond…
Q: ODD MAN OUT. Which of the following is not related to the other choices below? adenylyl cyclase…
A: Signaling is the process of communication between the cells, and between the cells and the…
Q: INCREASE in BP DECREASE in BP Increased preload Activation of the adrenergic system Venoconstriction…
A: The blood pressure alteration is influenced by many factors. The changes in blood pressure are…
Q: fat excess from the liver) in initial stages of liver cirrhosis, toxic liver lesions, and chronic…
A: Since, you have posted a question with multiple sub-parts, we will solve first three sub-parts for…
Q: Vhich of the following glycerophospholipid has a phosphate ester attached to a sugar moiety? O…
A: Introduction: Glycerophospholipids are the most abundant lipids present in the cell membranes. The…
Q: 1 Suppose that you have 1ml of a buffer solution with a pH of 6.8 and you add 1ml of 2% starch…
A: Salivary amylase is an enzyme that works on catalytic digestion of starch. Salivary amylase…
Q: When [I] is 10-7 M, 99% of P's activity is inhibited. What is the Kd of this Protein- Inhibitor…
A: Protein can function as enzymes, signal molecule, ligand, receptor, etc. Its function can be…
Q: Functional group as indicated by letters A,B,C and D?
A: Tamiflu is a drug made from the starting molecule shikimic acid. Tamiflu is a prodrug usually used…
Q: A newly developed qPCR has an efficiency of 75%, and each cycle is pretty consistent. In this qPCR,…
A: The qPCR is generally useful to determine the actual value of PCR product present at provided…
Q: Compare and contrast the de novo synthesis of purine and pyrimidine ribonucleotides. Move each…
A: There are two biosynthetic pathways for the synthesis of nucleotides: De novo pathway: The bases are…
Q: Fermentation occurs when is in too scarce amount to continue Its purpose is to re-generate so that…
A: “Since you have asked multiple questions, we will solve the first question for you. If you want any…
Q: Choose the wrong statement: Select one: O a. Competitive inhibitors competing with the substrate O…
A: Enzymes are the biological catalysts, that increase the rate of a chemical reaction. The enzymes may…
Q: When do plants usually undergo mitochondrial respiration?
A: Mitochondrial respiration is commonly known as cellular respiration. This is the process of energy…
Q: 4. The enzyme abundantly distributed in adipocytes and germinating seeds are A. proteases B. lipase…
A: "Since you have asked multiple questions, we will solve the first question for you. If you want any…
Q: V[Choose ] Collagen Coiled-coil of alpha helices Silk fibroin Keratin Triple helical arrangement of…
A: Triple helix : Has three strands which have the same axis and differ in translation along axis.
Q: Using DEAE-cellulose as ion exhange resin, indicate the starting and ending pH for the narrowest…
A: Ion exchange chromatography is used to separate the charged molecules such as amino acids and…
Q: 3. Based on the name of the following hypothetical drug salts, which of the following statements is…
A: The given options of hypothetical drug can be described as below in terms of acid and base:…
Q: Transcription in eukaryotic cells which is resistant to α-amanitin is carried out by which RNA…
A: RNA ploymerase arr the enzymes that synthesize RNA by reading the DNA strand. It copies DNA sequence…
Q: Describe surroundings at home which reminds you about biochemistry and relate the situation to…
A: Food is the source of different biomolecules, vitamins, and minerals for the body. Some of the food…
Q: 18:1c∆9 ω-9 fatty acid oleic acid both are correct neither is correct
A: In plants, animals, and microbes, fatty acid is a key component of lipids (fat-soluble components of…
Q: Topic: Photosynthesis Hi. I'm having trouble determining the answer to this question. I would like…
A: Photosynthesis is an anabolic process in which the carbohydrates are synthesized by using carbon…
Given Tagatose,
Briefly explain its expected reaction (based on their structural formula) to the different qualitative tests for carbohydrates which are: (a)Barfoed’s test (b)Seliwanoff’s test (c) Iodine’s test
Trending now
This is a popular solution!
Step by step
Solved in 2 steps
- Given ß- Cyclodextrin, Briefly explain its expected reaction (based on their structural formula) to the different qualitative tests for carbohydrates which are: (a)Barfoed’s test (b)Seliwanoff’s test (c) Iodine’s testUpon examining the test results for the unknown carbohydrate from all the tests depicted in the images, what are some of the identities of the unknown carbohydrate? Is it one of the sugars from the list in the Reducing or Nonreducing sugars test? if not what carbohydrate is it?Given Tagatose, Briefly explain its expected reaction (based on their structural formula) to the different qualitative tests for carbohydrates which are: (a) Molisch’s test (b)Fehling’s test (c) Bial’s test
- Given Raffinose, Briefly explain its expected reaction (based on their structural formula) to the different qualitative tests for carbohydrates which are: (a) Molisch’s test (b)Fehling’s test (c) Bial’s testGiven ß- Cyclodextrin Briefly explain its expected reaction (based on their structural formula) to the different qualitative tests for carbohydrates which are: (a) Molisch’s test (b)Fehling’s test (c) Bial’s testWHAT ARE THE ADVANTAGES AND DISADVANTAGES OF CARBOHYDRATES IN BIOCHEMISTRY? GIVE AT LEAST 3 FOR EACH AND EXPLAIN. WHAT IS THE PRINCIPLE AND APPLICATION OF BENEDICT'S TEST IN THE TEST FOR REDUCING SUGAR?
- Given Raffinose, Briefly explain its expected reaction (based on their structural formula) to the different qualitative tests for carbohydrates which are: (a)Barfoed’s test (b)Seliwanoff’s test (c) Iodine’s testGiven Sorbitol, Briefly explain its expected reaction (based on their structural formula) to the different qualitative tests for carbohydrates which are: (a) Molisch’s test (b)Fehling’s test (c) Bial’s testWhy do ketoses go dehydration reaction much faster than aldoses in Seliwanoff’s test when aldehyde reacts faster than ketoses? Kindly explain in a comprehensive manner.
- In solution, glucose exists predominantly in the cyclic hemiacetal form, which does not contain an aldehyde group. How is it possible for mild oxidizing agents to oxidize glucose?Given Sorbitol, Briefly explain its expected reaction (based on their structural formula) to the different qualitative tests for carbohydrates which are: (a)Barfoed’s test (b)Seliwanoff’s test (c) Iodine’s testIs D-2-deoxygalactose the same chemical as D-2-deoxyglucose? Draw and explain