Question 3 -- / 1 What form(s) of chemical energy are generated during cyclic photo-phosphorylation? 1 NADPH and ATP 2 NADPH only 3 ATP only No chemical energy is generated during 4 cyclic photo-phosphorylation
Q: OH HO NH2 O Cceramide O Sphingosine O Globoside O sphingomyelin
A: Lipid metabolism is the synthesis and degradation of lipids in cells, which includes the breakdown…
Q: uan used the ABO blood testing kit to determine his blood type. His test showed the following…
A: ABO blood grouping in humans: The RBCs of the one with blood group A have antigen A and the plasma…
Q: THE TADLE DY REFERRING T OTHE STEP Name of Reaction Reactant Enzyme Product Phosphorylation Glucose…
A: Glycolysis is the catabolic pathway in which Glucose is broken down into 2 molecules of 3C…
Q: Question 20 он NH но HO" "он cerebroside monoglycosyl ceramide glycosphingolipid O all are correct
A: Phospholipids are compound lipids composed of fatty acids, alcohol, and an additional group. Based…
Q: A. Name the two proteins that induce a negative feedback in this pathway and explain why both…
A: Since, you have posted multiple questions we will solve the first question for you. If you want any…
Q: 1) If a mutation caused an alanine to turn in glycine, what kind of effect do you think that would…
A: Alanine: An aliphatic amino acid with methyl (-CH3) group side chain and is non-reactive side chain…
Q: QUESTION; — Compare and contrast the degradation pathways of purines and pyrimidines, making sure to…
A: Nucleotides are used in nucleic acid synthesis, intermediate metabolic processes, and the breakdown…
Q: Which of the polysaccharides WILL DECREASE GELLING if acid is added to the sample? pectins…
A: Gels are solid, jelly-like structures made of colloid polysaccharides, proteins, and polymers…
Q: 29. Here is a strand of DNA: TACCCGGTATAACGCTGGAAAGCTTAAGCAACATCGCCCGACCCC AAATCT…
A: DNA strand given here with directionality is as: 5’…
Q: It is known that 80% of Penicillin is protein bound. Explain how most of it is being cleared from…
A: Penicillin is an antibiotic and a beta lactam drug. Penicillin upon administration into humans , go…
Q: A. Lysine: Polar basic: Calcium absorption B. Proline: Nonpolar imino acid: Protein synthesis C.…
A: A. Lysine is basic, has R group that is significantly positively charged at pH 7. It has second…
Q: What are the different types of RNA? Where are these types located within the cell?
A: Introduction: The structure of RNA is made up of a repeating strand of nucleotides that contain all…
Q: Describe the ion dynamics of the muscle-contraction process.
A: Tension-generating regions within muscle cells are activated during muscular contraction. Muscular…
Q: In a glucometer, glucose oxidase catalyzes the redox reaction of glucose to form gluconolactone.…
A: A glucometer is generally a little, portable device that helps to monitor (glucose levels) at home.…
Q: A polypeptide is shown below. Please answer the following questions. OH В A C H;N E H D H a. Match…
A: A polypeptide is a long, unbranched chain of amino acids joined by peptide bonds. To generate an…
Q: In the Biuret Assay for protein concentration determination, the role of sodium potassium tartrate…
A: The biuret test is a chemical test that can be performed to determine whether an analyte has peptide…
Q: Which base compositions for single-stranded RNA are possible? %A %G %C %T %U OA. All of the answers…
A: RNA are single stranded, their nucleobases donot participate in base pairing. According to the…
Q: Tabulate the main structural features of DNA and RNA. In one sentence, point out the salient…
A: Nucleic acids are made up of nucleotides. Nucleotides are the monomer units of nucleic acid.…
Q: I. True or Flase a. An inhibitor may compete with the substrate for binding to the active site of…
A: Enzymes are proteins which act as biocatalysts. Enzymes increase the rate of biochemical reactions…
Q: Question 8 O alpa-palmitoyl-beta-stearoyl-alpha-oleoyl glycerol O…
A: Triacylglycerols (TAGs) are the stored form of lipids, which are composed of three fatty acids and a…
Q: Can you please help me answer the following question in three paragraphs and in your own words.…
A: Enzymes are substances that enhance the rate of chemical reaction and facilitate the formation of…
Q: A newly developed qPCR has an efficiency of 75%, and each cycle is pretty consistent. In this qPCR,…
A: The qPCR is generally useful to determine the actual value of PCR product present at provided…
Q: 4. A solution containing egg albumin (pl-4.6), B-lactoglobulin (pl-5.2), and chymotrypsinogen…
A: Based on their isoelectric point, protein purification can be done in an ion-exchange column (pI).…
Q: Describe the basic features of the DNA double helix
A: DNA is Deoxyribo Nucleic acid . This is the biomolecule that is responsible for heredity in almost…
Q: 1. What are the three major pathways that eventually become entry points of molecules into the Krebs…
A: Hi! Thank you for the question, as per the honor code, we are allowed to answer the first…
Q: I want a solution that is 1/10th the strength of my stock solution. I want 20 microliters of total…
A: A solution can be diluted to the desired concentration by using the formula C1V1=C2V2 Where C1=…
Q: Both reducing monosaccharide and disaccharide give positive result in Barfoed's test. Which of the…
A: Barfoed's test is done to differentiate between monosaccharide and disaccharide.
Q: b. Two different liposomes have radii of 50.00 nm and 70.00 nm respectively. In a biopolymer…
A: Introduction: Liposomes are simple microscopic vesicles in which aqueous volume is enclosed entirely…
Q: Assume the energy of hydrogen bonds per base pair to be 5.86 kJ-mol-1. Given two complementary…
A: Given Energy of H-Bond per base pair = 5.86 kJ mol-1 Number of Base pair in complementary DNA = 145…
Q: Arrange signalling cascade events in chronological order.…
A: Signaling pathways helps to respond the cells according to the external stimuli. The external…
Q: For the Complex III in the electron transport chain: Complex III step 1: UQH2 is oxidized in a 2…
A: In the question there are two separate processes mentioned Two electron process One Electron…
Q: The molecules of a fatty acid (for example, fit closer together than the molecules of a fatty acid…
A: Fatty acids are composed of a long hydrocarbon chain attached to a carboxylic acid group. Fatty…
Q: In Table 13-1, what is the most common function of proteins that contribute to pattern formation?…
A: Drosophila melanogaster, a fruit fly, is utilised as a model organism in research spanning from…
Q: 6. DNA electrophoresis uses polyacrylamide gel for separation. a) True b) False 7. Agarose is a…
A: DNA is composed of nucleotides attached via phosphodiester bonds. DNA act as genetic material in…
Q: separating gel
A: here they talk about ion exchange chromatography and electrophoresis. Ion exchange chromatography…
Q: What are the main structural features of an amino acid?
A: Amino acids are compounds containing carbon, hydrogen, oxygen and nitrogen. They serves as building…
Q: Test Results + or -? Points awarded Code Glu – acidic end products yellow ______ _____+ Glu – gas…
A: Introduction: Microbial metabolic processes are complex but still, it permits the microbiologist to…
Q: Show the amount of ATP were produced in beta-oxidation of lauric acid, and differentiate both the…
A: Lauric acid has a 12-carbon backbone and is a saturated medium-chain fatty acid. Under anaerobic and…
Q: A man just ate a plant-based hamburger with a bun and nothing else on the sandwich.Coincidentally,…
A: As man ate plant-based hamburger with a bun. Plant based hamburger is made up basically from…
Q: Can someone please draw out phosphorylated creatine?
A:
Q: Kinesin-1 was the first member of the kinesin superfamily to be identified and therefore is perhaps…
A: Kinesin are one of the mejor cytoplasmic motors responsible for long range transport in all…
Q: 5' 3' For numbers 6 to 10, refer to the image above and answer the questions. 6. Which among the two…
A: Hi! Thanks for your question. As you have posted multiple questions and have not mentioned which one…
Q: Begining with 1 M concentrations of each reactant and product at pH=7 and 25.0 degrees C, calculate…
A: The reaction given in the problem is the reaction between Pyruvate to Lactate conversion which is…
Q: Match the each enzyme deficiency with their corresponding disease…
A: Different enzymes are required for synthesis of spingolipids. If these enzymes are not…
Q: Under what pH conditions can a protein not bind to the beads in a column? pH = -pKa pH =…
A: Proteins are composed of amino acids. There are a total of twenty standard amino acids that make up…
Q: 20. Beta-oxidation of fatty acids takes place at A. peroxisome B. mitochondria C. mitochondria and…
A: Beta oxidation of fatty acid - Process via which the fatty acids get broken down for energy…
Q: lycogen isolated from liver biopsy specimen had normal structure. Blood glucose level was below…
A: Introduction: Glycogen storage disease is a group of disorders that is characterized deposition of…
Q: 1. Is the Homo sapiens phenylalanine hydroxylase (PAH) gene encoding a non-coding protein or an…
A: Gene is a portion of the genome that can be transcribed or a functional unit of the genome…
Q: 7. Which of the following statement is true? A. oxidative rancidity is observed more frequently in…
A: Introduction: Rancidity is the development of unpleasant smells in fats and oils that is often…
Q: 4) Complete hydrogenation of TAG (Y) above would yield a TAG of what fatty acid composition?…
A: In the given table, fatty acid composition of three Tri-acyl Glycerol is given: TAG(X) =…
Step by step
Solved in 2 steps
- QUESTION 10 True or False: The energy released by oxidation of NADH in the electron transport system is used to pump protons up their gradient. Protons flowing down their gradient are in turn used to provide the energy for phosphorylation of ADP. True FalseQuestion 35Which statement about vitamin D is CORRECT? Question 35 options: Vitamin D induces the synthesis of proteins needed for the active transport of calcium across the intestine Vitamin D is most necessary when calcium intake is high Adequate consumption of vitamin D increases the absorption of calcium to 50% Vitamin D induces the synthesis of proteins needed for transport of calcium in the bloodstreamQUESTION 35 True or false? If a treatment were developed that could extend the lives of lung cancer patients by several years, the incidence of the disease would increase.
- Question 15 general , the mouse receiving the PTU in his / her food: 1. consumed more oxygen at all temperatures 2. ate more than the control mouse 3. consumed less oxygen at all temperatures 4. produced more oxygen at all temperaturesQuestion 23 options: A newly discovered colon cancer cell line is established from a tumour sample derived from a patient with colon cancer. To understand more about this cell line and how it is different from normal cells, some experiments on the cell cycle of the colon cancer line are carried out. The cells are examined under the phase contrast microscope and the length of mitosis was found to be 90 minutes. Next, a DNA marker is used to find out how long DNA synthesis takes and indicates that DNA synthesis takes 3 hours. There is a gap between DNA synthesis and mitosis of 3.5 hours and a gap between mitosis and DNA synthesis of 4 hours. What is the total length of the cell cycle? _____ hours?QUESTION 10 A 48-year-old female patient has breast carcinoma and presents to the hospital outpatient unit complaining of low energy. The physician orders hemoglobin and hemocrit counts, which were performed. After evaluation, it is determined the patient has anemia in neoplastic disease. The physician orders 3 units of packed red blood cells, which are transfused on the unit. Which coding is best for the blood products? (See the HCPCS options below.) HCPCS Code Descriptor P9010 Whole blood for transfusion, per unit P9021 Red blood cells for transfusion, per unit P9060 Fresh frozen plasma for transfusion, per unit, donor retested P9615 Catheterization for collection of specimen P9045 Infusion, albumin, 5%, 250 ml A. P9021 B. P9021 X 3 C. P9045, P9060 D. P9010 X 3, P9615
- QUESTION 17 Lungs: With age, lung function becomes "less efficient." Which one does not explain why? Lung tissue becomes more "elastic" resulting in less expansion. There is a decrease in "reserve capacity" that affects stamina. There is a decrease in the number of airs sacs for oxygen transport. Muscles in the rib cage become weaker and reduce contraction.Question 24 pts When we are vaccinated against SARS-CoV-2, what happens? (select all correct answers) Group of answer choices a) Our adaptive immune system becomes primed to recognize the SARS-CoV-2 virus. b) Our DNA becomes modified. c) We will permanently have viral proteins in our cells d) Our cells will make a partial or complete viral protein, which our immune system will recognize as foreign. e) Memory cells will be ready for a new infection.Question 1: Part a: Graph Y = [I] / (Ki + [I]) as a function of [I] and Ki = 2 µM; and describe the molecular situation. What is Y in terms of molecules? Pictures and words. Part b: Graph (1- Y) = Ki / (Ki + [I]) as a function of [I] and Ki = 2 µM; and describe the molecular situation. What is Y in terms of molecules? Hint: (1 - Y) is the part of the whole system that is not Y. Part c: ) Graph IIF = 1 + ([I] / Ki) as a function of [I] and Ki = 2 µM. Part d: What do you notice about the shapes of these graphs? Describe the shapes, compare and contrast the graphs, and suggest insights
- Question 37 Locard’s exchange principle states that, whenever two objects come into contact with one another, there is exchange of materials between them. a. True b. FalseQUESTION NO. 1 Cystic fibrosis is a frequent generic disease of Caucasians. The CF gene codes for a protein called the cystic fibrosis transmembrane conductance regulator (CFTR) which functions as a cAMP-regulated chloride channel. The protein has two membrane-spanning domains, two domains that interact with ATP, and one regulatory domain. The most common defect is in the gene for one of the ATP binding domains. The result is a protein that does not fold correctly in the endoplasmic reticulum, is not properly glycosylated, and is nor transported to the cell surface. Rather, it is degraded in the cytosol within proteasomes. Drugs that foster chaperone interaction with the mutant protein are a potential therapeutic approach. Chaperones A. are always required to direct the folding of proteins. B. when bound to protein increase the rate of protein degradation. C. usually bind to strongly hydrophilic regions of unfolded proteins. D. sometimes maintain proteins in an…Question 4How does an autopsy differ from a medico-legal autopsy? Discuss..