Six brilliant colors. Five types of tropical fish.GloFishExperience the Glo!How it got started?Explain the genetic modification done on these fishes.Advantages??Improvements? Are they just ornamental fishes?

Answered: Image /qna-images/answer/b149af5d-d7f5-42ec-be4c-0ac92275e7a2.jpg

Answered: GloFish Experience the Glo

Science

Biology

GloFish Experience the Glo

Human Heredity: Principles and Issues (MindTap Course List)

11th Edition

ISBN:9781305251052

Author:Michael Cummings

Publisher:Michael Cummings

Chapter14: Biotechnology And Society

Section: Chapter Questions

Problem 4QP: Genetically Modified Foods The creation of transgenic crop plants using recombinant DNA methods...

See similar textbooks

Related questions

Q: Questions A) what is the independent and dependent variable. B) what were the results of the…

A: Using three-dimensional computer animations of chimpanzees either yawning or with relaxed facial…

Q: Complete ventricular filling occurs during what phase of the cardiac cycle? a. when the atria are…

A: The heart is the part of circulatory system. It pumps blood to various parts of the body.

Q: What two important characteristics allow us to identify a cell in interphase?

A: An active living cell undergoes two major phases - the mitotic phase where the cell divides into two…

Q: An anticodon strand reads 5'-IAG-3'. Fill in the missing base sequences for the possible codons…

A: The anicodon is 5' IAG 3' so the codon for this anticodon would be 5' TGC 3' if the I were to be…

Q: Consider the image below. This image shows plasmid DNA isolated through exactly the same method that…

A: Plasmid DNA In contrast to a cell's chromosomal DNA, plasmidsare tiny, circular, double-stranded DNA…

Q: Fill in the blanks. Blanks with the same letter are the same molecule. Molecules to use:…

A: Water is necessary for transpiration, photosynthesis, and respiration in order for plants to grow…

Q: Anaphase A. Is the phase during which sister chromatids separate and move to opposite poles b.…

A: Mitosis is the division of a diploid (2n) mother cell and production of two diploid (2n) and…

Q: Answer these questions in a You may include labeled drawings or tables, if helpful. Short answers,…

A: Countless trillions of chemical reactions take place daily in our bodies to support vital metabolic…

Q: 4. Which structure protects the plant body against the invasion of parasites?

A: Parasites It refers to an organism that lives on or inside a host organism. It obtains sustenance…

Q: Besides the pUC series, there are other plasmid vectors in the market such as pBR327 and pGEM-T.…

A: Cloning methods are used in biotechnology for various purposes. TA cloning is the technique that…

Q: Which of the structures highlighted in the image contains a transverse flagellum?

A: Protists are unicellular eukaryotes. They lack the tissue level of body organization and have cilia…

Q: Describe the feeding biology of centipedes, spiders, mites and beetles. Compare and contrast these…

A: We know that centipedes, spiders, mites, and beetles belong to the phylum Arthropoda and which is…

Q: The digestive system has several important functions. The physiological processes involved in the…

A: Food is broken down by the digestive process in the body so that it could be ingested and used as…

Q: 1) Using Punnett Squares, determine which genotypes are possible at each gene locus if you cross…

A: Mendelian inheritance describes specific patterns of how features are passed down from parents to…

Q: Out an outbreak investigation for communicable diseases is key in disease prevention. Examine the…

A: A communicable disease is one that transmits from one person or animal to another. These diseases…

Q: interpret constructively the given iris scatterplot below

A: The iris is the colored part of the human eye. Muscles in our iris control our pupil that is the…

Q: The haploid number of chromosomes in a cell of a grasshopper is 18. How many chromosomes are in a…

A: A chromosome is a lengthy DNA molecule that contains all or a portion of an organism's genetic code.…

Q: Which statement about metabolic pathways is false? OA. A specific enzyme catalyzes each…

A: Metabolic pathways are set of reactions catalysing conversion of one substrate into some product.…

Q: At 260 nm what component of DNA absorbs at this nm(hydrogen bond, phosphate backbone, nitrogenous…

A: Answer : Due to the resonance nature of the purine and pyrimidine bases, nucleic acid strongly…

Q: 8.The arm is known as the ________ region; the neck is known as the ________ region.? a. otic;…

A: Introduction :- The network of nerves known as the brachial plexus transmits information from the…

Q: 47. Expansion of the extracellular fluid volume leads to an increase in the plasma concentration of…

A: Whenever the extracellular volume is decreased, Anti Diuretic Hormone, aldosterone, and angiotensin…

Q: features of adaptation” may influence program design for a given population.

A: What Features of adaptation in animals leads to influence the population?

Q: You have just completed a plasmid DNA isolation procedure, but when you measured the amount DNA you…

A: Proteins are the large biomolecules and macromolecules that comprise one or more long chains of the…

Q: Twenty hoki (sea fish) are translocated into an aquaculture facility for research. The hoki are…

A: The number of three different genotypes are given: CC 1 CG 7 GG 12

Q: WHO is Henry Lowe ? what what did he created?

A: Dr Henry Lowe was born on April 9, 1939. He is a scientist and businessman in the health industry.…

Q: From a cross between individuals with the genotypes Cc Dd Ee × cc dd ee, 1000 offspring were…

A: Given that, a cross has been made between Cc Dd Ee and cc dd ee and 1000 offspring were produced.…

Q: TELOPHASE + Cytokinesis: Find and observe a telophase. Sketch or paste it on the right

A: Mitosis and meiosis are the two distinct processes of cell division. When we talk about "cell…

Q: II. Cultural characteristics of yeasts. Below is the colony diameter for each yeast culture grown on…

A: Yeasts are single-celled, eukaryotic microorganisms that belong to the fungal kingdom. There are…

Q: What is the major difference in the functions performed by the conventional PCR and real time PCR?…

A: PCR REAL TIME PCR A technique to amplify a segment of DNA , generating millions of copies of a DNA…

Q: What determines the resolution limit of a microscope? Is the purpose of the fluorescence microscope…

A: Limit of Resolution is the ability of objective lens two clearly separate the two points of the…

Q: Some friends are trying to make wine in their basement. They've added yeast (which is a facultative…

A: Introduction The metabolic process of fermentation involves the action of enzymes to cause chemical…

Q: Polymerase chain reaction (PCR) is a technique that enables multiplication of specific DNA sample at…

A: The polymerase chain reaction (PCR) was hugely successful in molecular biology. PCR tests are…

Q: Under anaerobic conditions, OA. lactate O B. oxygen O C. pyruvate O D. carbon dioxide E. glucose is…

A: Anaerobic and aerobic cell respiration are the two main forms of Cellular Respiration. One takes…

Q: When a cell uses fats for aerobic cellular respiration, it first hydrolyzes (breaks down) fats to…

A: Introduction :- The process of cellular respiration that occurs in the presence of oxygen gas in…

Q: a man with depressive disorder is contributed in drug study that inhibit the b2 conversion to its…

A: A man with depressive disorder contributing in drug study that inhibits the conversation of b2 into…

Q: Identify which of the two major stages in the conifer life cycle that correspond with the letters on…

A: Gymnosperms are flowerless plants, and their meaning in greek is naked seeds. They are second in the…

Q: Describe four different uses for thoracic appendages seen in different crustaceans. Use specific…

A: Crustaceans form a large, diverse arthropod taxon which includes animals such as decapods, seed…

Q: Describe the process of protein synthesis and trafficking of a protein, a lysosomal hydrolase,…

A: Introduction All cell membranes that exchange lipids and proteins are included in the endomembrane…

Q: Polymerase Chain Reaction (PCR) was invented by Kary Mullis in 1983. This technique had indeed…

A: The annealing temperature is the temperature at which the primers bind to the denatured DNA strands.…

Q: 16. Nitrogen bases pair with bases that are O available identical complimentary O opposite

A: Introduction : The centromere is the region of the chromosome that attaches to a spindle fibre at…

Q: BasH II Kpnl Dra TTGTAAAACGACGGCCAGTGAGCGCGCGTAATACGACT…

A: Many people agree that one of the 20th century's most significant contributions to molecular biology…

Q: Is it possible to perform DNA profiling with SNPs instead of SSRs as DNA markers, but in general you…

A: SNPs are used by geneticists as markers to find genes in DNA sequences. Suppose a gene alteration…

Q: Consider the following scenario: Molecule X is highly concentrated outside of a cell membrane.…

A: The transportation of molecules across the plasma membrane depends on their concentration gradient…

Q: Differentiate between the following terms used in medical epidemiology: 4.1. Sporadic vs endemic…

A: Sporadic refers to a disease that occurs infrequently and irregularly, it does not show any common…

Q: G3A (G at position 3 was changed to A) G9A Deletion of TCA at position 18-20 C22A T31A, A32T double…

A: The Mendelian gene is a basic unit of the heredity and the molecular gene is a sequence of…

Q: Which of the following statements concerning glycogen in different tissues is TRUE? a. Liver…

A:  (a)  To Determine: If the…

Q: Homologous chromosomes come together and line up along their entire lengths A. in meiosis in…

A: Meiosis is a unique form of germ cell division in sexually reproducing animals that results in the…

Q: How are ATP and NADH similar? OA. Both molecules are oxidized by molecular oxygen (O2) in reactions…

A: ATP- Cells consume and store energy from adenosine triphosphate (ATP), which is the energy source.…

Q: Percent Change in Weight (%) 10 5 0 -15 -20 -25 -30 Osmosis and it's Effect on Potato Weight Change…

A: Passive diffusion is a type of membrane transport mechanism in which substances moves from high…

Q: 0 0 0 0 0 a mutation in a 5' or 3' splice site must alter the sequence of the protein encoded by a…

A: The gene is the functional part of the DNA that undergoes transcription process and responsible for…

Concept explainers

Substance Abuse

Substance abuse refers to the use of illegal drugs in excessive quantities, as well as the misuse of legal substances such as prescription or over-the-counter pharmaceuticals or alcohol for purposes other than those intended. Drug addiction, also known as substance use disorder, is a disease that affects the brain and behavior of a person. It leads to a failure to control the use of any drug or prescription, legal or illegal.

Question

100%

Six brilliant colors. Five types of tropical fish.
GloFish
Experience the Glo!
How it got started?
Explain the genetic modification done on these fishes.
Advantages??
Improvements? Are they just ornamental fishes?

Expert Solution

This question has been solved!

Explore an expertly crafted, step-by-step solution for a thorough understanding of key concepts.

SEE SOLUTION Check out a sample Q&A here

Step 1

VIEW

Step 2

VIEW

Step by step

Solved in 2 steps with 2 images

SEE SOLUTION Check out a sample Q&A here

Knowledge Booster

Learn more about

Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.

Similar questions

- cytogenetics- Give me an example of make up a crime scene scenario in which DNA from a nonhuman provided critical evidence.
True/False True or False? Transposon mutagenesis is useful for identifying essential genes in a cell. True or False? Transposons are found at various levels of complexity in bacteria. True or False? Transposons in eukaryotes are mechanistically different from bacterial transposons.
True/false? if false, justify briefly DNA synthesis during the S phase is extremely rapid. Cells undergoing the S phase are thus extremely sensitive to rays and chemicals.
Central Dogma of Molecular Biology from DNA to RNA to Protein, discussing the principles underlying the transfer of information in a biologic system and its regulation. However, recent research seems to challenge certain aspects of Crick’s Central Dogma. Does the Central Dogma still stand today? If not, can you find an example for a type of information transfer that is not explicitly covered by the Central Dogma (or even violates it)?
True/false? if false, justify briefly The bacterial nucleoid comprises linear nucleic acid molecules associated with proteins that ensure the compaction of nucleic acids.
PLEASE ANSWER WHY? Some substitution mutation result in a malfunctioning protein but others do not. Why is this?
Yes or no? DAPI just stains dna in testes and sperm of planarian. A of riboprobe duryin situ hybridization pair with T's in mrna . T with A, cwith G and G with C. in forward genetics phenotype is known before the gene mutation and in reverse genetics the altered gene is known before phenotype
Genetically Modified Foods The creation of transgenic crop plants using recombinant DNA methods involves the transfer of just one gene or a small number of genes to the plants, in contrast to classical breeding methods in which hundreds or even thousands of genes are transferred at once. Explain why this is true. If fewer genes are transferred during the creation of transgenic crops, why are some people afraid that they are dangerous?
Genetic application problem A couple in which the woman belongs to group 0 Rh- and the man is AB Rh + claim as theirs a baby whose blood is A Rh +. What would you think as a judge about this lawsuit? Explain...
General Biology - Help me do this activity, you can read the instructions for clarification, thanks!
True or false? Some humans are genetically modified.
Junk DNA — Not So Useless After All | TIME.com What was the scientist's error in naming noncoding DNA “junk” DNA. Is the amount of DNA an organism has correlated to intelligence or complexity? What are two discovered uses of noncoding DNA (introns)?