Glucagon causes [Select] Glucagon cause [Select] [Select] ✓ [Select] Glucagon causes [Select] ✓[Select] phosphorylation dephosphorylation phosphorylation dephosphorylation of glycogen phosphorylase and of glycogen synthase. of glycogen phosphorylase and or giyooyen synthase. of glycogen phosphorylase and of glycogen synthase.
Q: Compare the molecular property of amino acids and their roles in protein folding.
A: There are 20 general proteogenic amino acids (amino acids that are often found in proteins). These…
Q: 3) An enzyme that converts a functional group to another between two structures, A) oxidoreductase…
A: Since you have posted multiple questions, we will provide the solution only to the first question as…
Q: 2. Scheme of anaerobic oxidation of glucose and energy balance.
A: Organisms that live under anaerobic conditions rely only on glycolysis to generate ATP. Glycolysis…
Q: a) It is known that double stranded DNA is denatured at low pH. pKa…
A: When a DNA solution is heated enough, the double-stranded DNA unwinds and the hydrogen bonds that…
Q: Do carbohydrates and sugars cause weight gain? Briefly Explain the answer.
A: Carbohydrates are biomolecules that act as the major source of energy. Sugars are carbohydrates with…
Q: 1) Perform the necessary calculations and fill in the values in the table below (be sure to include…
A: Enzymes are usually comprise of protein molecules which is used to catalyzed several biochemical…
Q: Describe the biochemical mechanism by which RNA splicing occurs precisely at the exon-intron borders…
A: One notable difference between prokaryotic genes and eukaryotic genes is that prokaryotic genes do…
Q: What percentage of Vmax is obtained when the substrate is present at 80% of the KM? Use two digits…
A: Vmax is the maximum velocity attained by an enzyme during a reaction. Km is the substrate…
Q: 1 starting with datp and dctp draw the synthesis of d(ac) dinucleotide. 2 draw the guanine…
A: "Since you have asked multiple questions, we will solve the first three questions for you. If you…
Q: LO 53- Determine the type of mutations based on the effect in the amino acid chain "missense,…
A: Missense, non-sense and silent mutation are the types of point mutation. In point mutation, one base…
Q: 3. After the competition, the athlete's lactic acid content is 4 mmol/l. Can this be considered a…
A: Lactate is created more quickly and cannot be removed, it builds up in muscle fibers. Lactate is a…
Q: The Na,K-ATPase is a(n) [Select] [Select] and K+ from [Select] that moves Na+ from
A: When 2 species are transported in the same direction by a transporter, this type of transport is…
Q: A pentapeptide has the abbreviation "GREAT". Draw the peptide and give its systematic name.
A: Peptides are short sequences of amino acids. Amino acids in a peptide are joined together through…
Q: Several problems not applicable to synthetic drugs often influence the quality of herbal drugs -…
A: Synthetic drugs are the pure form of a compound prepared and approved by testing in several trials.…
Q: true/false: Humans produce isoleucine using pyruvate as a starting material.
A: Proteins are composed of amino acids, which are bound together by peptide linkage. Amino acids…
Q: A patient on dapsone begin to experience dizziness and vertigo 3 days after taking his medication.…
A: Cyanotic defects: Cyanosis is a condition caused by cyanotic defects, in which the blood pumped to…
Q: Muscle glycogen phosphorylase, an enzyme that provides glucose to the muscle for energy production,…
A: Enzymes are highly specialized proteins that have extraordinary catalytic power, greater than that…
Q: Which of these chemicals damages the brain in a way that resembles Parkinson’s disease? A. Capsaicin…
A: Dopamine is a neurotransmitter. It is synthesised by dopaminergic neurons. Parkinson's disease is…
Q: Are there anymore features that limit the protein configurations?
A: A protein's biological function depends on its three-dimensional structure. The 3D structure is…
Q: Draw a lipid exhibiting both an ether-linked and ester-linked acyl group attached to a glycerol…
A: Lipids are made up of fatty acids. they are insoluble in water. Lipids are important constituents of…
Q: Draw structure of Cytosine, Thymine and Uracil and describe the difference in the structure?
A: Nucleotides vs nucleosides Nucleosides are pentose sugar(ribose in the case of RNA and deoxyribose…
Q: How does alteplase and mannitol affect a laboratory result? Why is it important to inform the lab…
A: Introduction An ischemic stroke is a condition when the blood supply to part of the brain is reduced…
Q: Biologically important steroids: (sterols – cholesterol and its derivatives, bile acids, steroid…
A: Steroids are derivatives of Cyclopentanoperhydrophenanthrene ring containing compounds. They have…
Q: Effect of intramolecular and intermolecular forces of attraction to protein folding?
A: INTRODUCTION : Protein folding - It is a natural process through which a polypeptide chain is being…
Q: Which reaction or reactions of glycolysis require NAD* as a reactant? Which reaction or reactions in…
A: Cellular respiration is the process how biochemical energy is generated from food. It involves the…
Q: Electron transport chain. Complex 2
A: Electron transport is a succession of redox reactions, much like a relay race. It is a component of…
Q: Questions and Problems 7. Explain the difference in enzyme activity before and after heating. 3. Why…
A: Enzymes are high molecular weight protein molecules that catalyse biochemical reactions. The…
Q: Experiment: DNA Extraction from Banana The procedures are attached below. Question: 1. Will the…
A: DNA is the genetic material that is presented inside the nucleus of every cell. Banana is the best…
Q: Over the course of glycolysis and the citric acid cycle, there are 10 NADH and 2 FADH₂ produced per…
A: Number of ATP formed from each molecule of NADH and FADH2 through oxidative phosphorylation helps in…
Q: Using a Venn include when
A: DNA replication is a vital biological process of producing identical copy of DNA using enzymes DNA…
Q: Draw the structure of the following: (in the image provided) Use the amino acids below. F -…
A: Recall that: Amino acids have an amino group, a carboxyl group and a side linked to the same carbon…
Q: Select ALL statements that are true about the isoelectric point (pI) of a protein a.Protein carries…
A: The isoelectric point (pI) of a protein is the pH at which the protein is neutral or the overall…
Q: Why does glutamate the only amino acid used in oxidative deamination
A: Glutamate is an acidic amino acid that acts as the only amino acid used in oxidative deamination.…
Q: What are the greatest structural features that differentiate sphingolipids from phosphoglycerides?
A: Lipids are a very important class of biological molecule. Lipids are a broader class of molecule…
Q: If the target protein is 0.1% of the total protein in the original mixture, a three-step…
A: Purification is a process by which impurities are removed from a sample and desired component is…
Q: Describe how the activity and specificity of ribonucleotide reductase (RNR) is regulated.
A: Ribonucleotide reductase (RNR) catalyzes the rate-limiting step in the only known de novo pathway…
Q: 2. Complete the following for serine, tyrosine, and gylcine. a. Draw the amino acid. b. Circle the…
A: Amino acids are the building blocks of proteins. they can be classified into different groups based…
Q: Using the results of linear regression analysis (log(MW, kDa) vs Rr) from the protein standards,…
A: Given that the linear regression analysis data of a plot of Log MW (in kDa) vs Rf is given as:…
Q: Reaction of alkaline, acid and enzymatic hydrolysis of triacylglycerols.
A: Triacyl glycerols are triglycerides which are formed from 3 molecules of fatty acids and one…
Q: Could you help with part d? Create a speciation diagram for histidine by plotting Xi vs pH from pH =…
A: His is a basic amino acids with pKa value of its side chain ~6, amine and carboxyl groups pKa values…
Q: Questions 11-13- refer to the carbohydrate mannose (open chain and one anomeric ring configuration…
A: Carbohydrates are polyhydroxy aldehydes or ketones. They can be classified as monosaccharides,…
Q: 5. Which of the following is true about myoglobin and/or hemoglobin? O (a) The iron in Hb is in the…
A: Both hemoglobin & myoglobin are globular proteins. Our red blood cells (RBCs) are composed of…
Q: Which of the following is TRUE? Both AMP and ADP are negative regulators of glycogenolysis. O ATP…
A: Glycolysis is the catabolic pathway in which glucose is broken down into pyruvate that enters TCA…
Q: All lipids are absorbed into absorptive cells of the small intestine by which process? Primary…
A: The biological membrane that surrounds a living cell is called the cell membrane. The structure of…
Q: Please depict a noncovalent interaction important for the function of lysozyme
A: The enzyme lysozyme aid in the breaking down of polysaccharides in the bacterial cell membrane. They…
Q: Mucic Acid Test for Galactose and Lactose Galactose, on being oxidized with HNO3 forms mucic acid,…
A: Carbohydrates are polyhydroxy aldehydes or ketones. They can be classified into monosaccharides,…
Q: 1. Compute the concentration of the standard solutions by completing Table B.1. Report your answers…
A: Bradford assay is a method to estimate the protein concentration in the given sample. It is based on…
Q: A researcher found that a single point mutation in the genome of the SARS-CoV-2 virus resulted in a…
A: Amino acids are biomolecules that have an amino group and a carboxyl group linked to the same carbon…
Q: LO43 Identify the levels at which gene expression can be regulated in prokaryotes and eukaryotes…
A: Gene regulation is the process of control of expression genes. This process occurs by several…
Q: 5'- ATTGTGATATGGCCACCTGCCACCTGGAGAGCAGCT GATTAG-3' What oligopeptide is encoded by the above…
A: The DNA contain genes (functional unit) that encode protein molecules. Proteins are the "workhorses"…
Q15
![Glucagon causes [Select]
[Select]
Glucagon cause
[ Select]
✓ [Select]
phosphorylation
Glucagon causes
✓ [Select]
phosphorylation
dephosphorylation
dephosphorylation
[Select]
of glycogen synthase.
clara
of glycogen phosphorylase and
of glycogen phosphorylase and
vi giyuuyun oynithase.
of glycogen phosphorylase and
of glycogen synthase.](/v2/_next/image?url=https%3A%2F%2Fcontent.bartleby.com%2Fqna-images%2Fquestion%2F2b8d26a8-87eb-4d55-9239-418c1bd04690%2F49ef9ebc-25ab-4bc6-af8f-592e44601c0b%2Fs2azkyb_processed.jpeg&w=3840&q=75)
Trending now
This is a popular solution!
Step by step
Solved in 2 steps
- If protein phosphatase 1 (PP1) is inhibited does Glycogen Synthase Kinase 3 become more active?Describe the impact of phosphorylation of glycogen phosphorylase on its heterotropic regulation. (Don’t need the structural details; focus on the qualitative effects on allostery; be brief and to the point)A cell where PKBPKB is always active has a mutation that results in the permanent activation of GSK3GSK3. Based on the information in Figure 2, predict the effect of this mutation on the activity of glycogen synthase. Justify your prediction.
- The epinephrine-mediated “amplificationcascade” of Figure 24.14 has six steps, all of which are catalyticwith one exception. This cascade leads to the activation of glycogenphosphorylase. This enzyme acts in turn on glycogen to yieldglucose-1-phosphate (G-1-P).(a) Which step is not catalytic?(b) If each catalytic step had a turnover (molecules of substrateacted on per molecule of enzyme) of 10, how many moleculesof G-1-P would result from one molecule of epinephrine?(c) What is the biochemical advantage of such a cascade?(d) How is the amplification cascade of this questionreversed?At body temperature, L-aspartate in proteins race-mizes to D-aspartate at an appreciable rate. Most pro-teins in the body have a very low level of D-aspartate, if itcan be detected at all. Elastin, however, has a fairly highlevel of D-aspartate. Moreover, the amount of D-aspartateincreases in direct proportion to the age of the person fromwhom the sample was taken. Why do you suppose thatmost proteins have little if any D-aspartate, while elastinhas levels of D-aspartate that increase steadily with age?Glycogen synthase catalyzes glycogen synthesis. Determine whether each intermediate is associated with an “increase” or “decrease” and or “no effect” on the activity of glycogen synthase. Glucose 6-phosphate – cAMP –
- The Vmax of muscle glycogen phosphorylase is much larger than that of the liver enzyme. Discuss the functional signifi cance of this phenomenon.Can you explain the allosteric regulation of glycogen synthase and glycogen phosphorylase?Von Gierke’s disease is also known as glycogen storage disease type I. Patients with von Gierke’s disease lackglucose 6-phosphatase activity. Two prominent symptoms of this disorder are fasting hypoglycemia and lactic acidosis (elevated lactate levels in the blood), especially during strenuous exercise. Explain why these symptoms occur. What chemical reaction does this enzyme catalyze? Which pathways involve this enzyme? Lacking thisthe enzyme will cause impairment of which pathways?• Pls consider what pathways are affected by Von Gierke’s disease. Include in your explanation involving Cori’s cycle. can you please do not write by your hand? I mean computer if you can. thank you
- Will the amount of glycogen be higher or lower than normal or unchanged? Pyridoxal phosphate is covalently bonded to glycogen phosphorylase via a Schiff base to Lys 680. What effect would the mutation of Lys680Ala have on the breakdown of glycogen?(This notation means the following: K680 is the normal amino acid in this enzyme. It has been mutated to 680A.) Loss of the gene for the kinase that phosphorylates GSK3 on glycogen synthesis. Effect of the substrate analog below on glycogen synthesis.Explain the Phosphorylation of glycogen phosphorylase by phosphorylase kinase mechanism. What is happening in each step? what are activating nucleophiles and stabilizing intermediates?A Deficiency on 3-Phosphogtycerate Dehydrogenase Can Affect Amino Acid Metabolism Although serine is a nonessential amino acid, serine deficiency syndrome has been observed in humans. One such form of the syndrome is traceable to a deficiency in 3-phosphoglycerate dehydrogenase (see Figure 25.31). Individuals with this syndrome not only arc serine-deficient but also arc impaired in their ability to synthesize another common ammo acid, as well as a class of lipids. Describe why.