help
Q: What is the function of the active site of an enzyme? a. Involved in the catalytic reaction of the e...
A: Enzymes are organic substances produced by living cells. Enzymes are referred to as biocatalysts i.e...
Q: por favor help me answer these 2 questions.
A: The human blood types are of 4 different types that are A, B, AB, O. Each blood group (phenotype) is...
Q: Which nucleotides break the rules of Watson–Crick base pairing when they are found at the wobble pos...
A: The nucleotide which break the rules of Watson-Crick base pairing when they are found at the wobble ...
Q: How Is Glycogen Synthesized?
A: Carbohydrates are the most important storage molecules that get metabolized to serve the body's ener...
Q: cis, cis-9,12-OCTAdecadiENoic acid Enumerate the number of carbons and unsaturations (double bonds) ...
A: Linoleic acid is also known as Ocatadecadienoic acid is a polyunsaturated essential fatty acid that ...
Q: A scientist seeks to synthesize a blood clotting factor protein in lab. To perform this experiment,s...
A: The eukaryotic and prokaryotic system is different the transcription and translation process is diff...
Q: Why do leaves of plants appear green? Would plants grow well in greenish-yellow light? Explain your ...
A: Reflection is the process that occurs when the light rays hit a non-luminous or mirror or a polished...
Q: Explain what are the main differences in the cellular location of the sets of chemical reactions kno...
A: All organisms require energy to do work. The energy is obtained by aerobic or anaerobic metabolism. ...
Q: List and explain two ways that this transcription factor (HIF-1α) relates to glucose metabolism.
A: HIFs or hypoxia-induced factors are transcription factor molecules involved in the regulation of gen...
Q: Explain how it is possible that some tRNA molecules recognize more than one codon.
A: The RNA molecule, transfer ribonucleic acid (tRNA), aids in the translation of a messenger RNA (mRN...
Q: 1. In the preparation of the standard curve for protein analysis, 50 mnBSA (bovine serum albumin) di...
A: Given values: 50 mg of BSA was dissolved in 5 ml of water. So, the concentration of BSA in the stoc...
Q: Can Systems Analysis Simplify the Complexity of Metabolism?
A: To simplify the metabolism of heterotrophic cell, it can be divided into three major blocks cataboli...
Q: How are the physiological processes are dictated by the laws of chemistry and physics?
A: The fundamental processes in the body of human beings like metabolism, movements, reproduction, cell...
Q: What is the difference between a missense mutation and a nonsense mutation? Between a silent mutatio...
A: Introduction: The change in the sequence of the DNA is mutation.
Q: What is the stoichiometry of the synthesis of (a) ribose 5-phosphate from glucose 6-phosphate withou...
A: Stoichiometry involves the relationships between the reactants and/or products in the chemical react...
Q: What accounts for the fact that liver phosphorylase is a glucose sensor, whereas muscle phosphorylas...
A: In Liver the glucose is not the main source of energy of the tissue. whereas in muscles glucose is t...
Q: Explain what an oxidation–reduction reaction is and why the breakdown ofglucose in the presence of o...
A: A chemical reaction is a process where two or more substances react together to form new or differen...
Q: 1) A drug called Bamlanivimab can be used to treat infections with SARS-CoV-2 (Covid-19).This drug w...
A: ‘Chromatography’ is defined as an analytical technique used to separate a mixture of chemical substa...
Q: How does the use of restriction endonucleases of different specificities aid in the sequencing of DN...
A: Restriction endonucleases of different specificities cleave DNA at specific sites.
Q: ____________________ is the structural glucose-containingpolysaccharide of plants.
A: Introduction: Cellulose.
Q: Why is it called beta oxidation explain in detail, draw a flow chart labelling each step of the path...
A: Beta-oxidation is a metabolic process involving multiple steps by which fatty acid molecules are bro...
Q: The urea cycle occurs partially in the cytoplasm andpartially in the mitochondria. Discuss the urea ...
A: Urea is the final product of the amino acid or protein metabolism. The nitrogen present in the amino...
Q: How Does Protein Degradation Regulate Cellular Levels of Specific Proteins?
A: Protein degradation occurs in either a lysosome or a proteasome. The protein that is to be destroye...
Q: What is the Warburg effect? Whywould cancer cells favor such inefficient metabolism?
A: Via the oxidation of its carbon bonds, glucose, the essential macronutrient, allows energy to be har...
Q: In an expository essay: How did the concepts of globalization or regionalism help in addressing the ...
A: COVID 19 is a pandemic, it affected the whole world and reason in several deaths within one year.
Q: What Underlying Principle Relates ATP Coupling to the Thermodynamics of Metabolism?
A: ATP is adenosine triphosphate that stores energy in its phosphate bonds. When ATP changes into ADP, ...
Q: Alcoholics tend to be malnourished, with thiamine deficiency being a particularly severe problem.Sug...
A: Thiamine (Vitamin B1) deficiency is a medical condition which leads to low levels of Thiamine which ...
Q: Calculate the amount of ATP produced by each glucose molecule entering cellular respiration.
A: Introduction: Cellular respiration is the process by which individual cells digest food molecules li...
Q: How can breakdown in DNA repair play a role in the development of human cancers?
A: DNA : It is the chemical name for the molecule that carries genetic instructions in all living thing...
Q: The insertion of a base in a coding sequence leads to a shift in the reading frame, which in most ca...
A: A frameshift mutation in the process, in which the addition of the bases in the nucleotide sequence,...
Q: What are polyubiquitin linkages ?
A: Ubiquitin is a protein made up of 76 amino acids. It regulates the movement of proteins in the cell....
Q: A fed vs. fasted question - IN GENERAL, describe how opposing pathways are regulated during fasting ...
A: There are three major metabolic states of the body such as the absorptive or fed state, postabsorpti...
Q: How does glycogen differ from starch in structure and function?
A: Introduction: A carbohydrate is a biomolecule consist of carbon (C), hydrogen (H), and oxygen (O) at...
Q: Distinguish among the three types of glycosphingolipids,cerebrosides, sulfatides, and gangliosides
A: Introduction: Glycosphingolipids are glycolipids that contain the amino alcohol sphingosine. They ca...
Q: How Are Steroid Hormones Synthesized and Utilized?
A: A steroid hormones is a steroid that acts as a hormone. It can be grouped into two classes corticost...
Q: increase the affinity”, “decrease the affinity” or “no change in affinity i) Myoglobin ii) ...
A: Myoglobin and hemoglobin both are oxygen-binding proteins that are present in muscles and red blood ...
Q: What properties of DNA make it especially well suited to serve as the genetic material?
A: DNA is a type of nucleic acid. It is a polymer of nucleotide. Initially RNA is believed to be the ge...
Q: The following image is a schematic of the metabolic processes occurring in a plant contained in a cl...
A: In the given figure, two metabolic pathway is shown that is photosynthesis and respiration in plant.
Q: A new ATP-producing protein is discovered that couples ATP production to the oxidation of NADPH by o...
A: Introduction: a. 60 kJ/mol free energy is wasted under standard conditions. b. Two more ATP molecule...
Q: : Explain the reason why people with sickle cell trait, AS, have protection against malaria.
A: Sickle cell anemia is a group of disorders that cause red blood cells to become loose shape and beco...
Q: What Are the Optical and Stereochemical Propertiesof Amino Acids?
A: Amino acids possess stereochemical properties as they contain chiral centers and are enantiomeric mo...
Q: Aspirin and ibuprofen, over-the-counter pain killers inhibit an enzyme (prostaglandin synthase) whic...
A: Aspirin and ibuprofen are the NSAIDs (Non Steroidal Anti-inflammatory drugs), these drugs primarily ...
Q: What Are Buffers, and What Do They Do?
A: Buffers : A buffer is a solution of a weak acid and its conjugate base that has the ability to resis...
Q: What would be the characteristics of a transition-state analog for the chymotrypsin reaction?
A: Introduction: Enzymes are proteins that act as a catalyst which means they increase the rate of chem...
Q: What's the best definition of gene therapy? a) The introduction of a non-mutated and functional gene...
A: During cell division, deoxyribonucleic acid (DNA) is an inherited molecule that passes genetic infor...
Q: Imagine your research lab is studying the anti-aging effects of a phytochemical. Which of the follow...
A: Phytochemicals are defined as metabolites produced by plants. They are found in vegetables, grains, ...
Q: How can the synthesis and breakdown of fructose-2,6- bisphosphate be controlled independently?
A: Cellular respiration is a catabolic pathway of the process of metabolism, where a series of chemical...
Q: The pH of a solution containing 20 mL of 0.120 N NaOH and 35 mL of 0.120 N NaOH is 1.49. True or Fal...
A: Given Values: 20 ml of 0.12 M NaOH and 35 ml of 0.12 M NaOH are mixed together. The pH of the mixed ...
Q: How many unpaired electrons has the element Se (Selenium) in its ground state? * O 4 unpaired electr...
A: Electronic configuration tells how electrons are distributed in different orbitals.
Q: Which aseptic technique is crucial and which is cost effective?
A: Aseptic technique refers to using practices and procedures to prevent contamination from pathogens. ...
help
Step by step
Solved in 3 steps
- If the coding region of a gene (the exons) contains 2,100 base pairs of DNA, would a missense mutation cause a protein to be shorter, longer, or the same length as the normal 700 amino acid proteins? What would be the effect of a nonsense mutation? A sense mutation?Shown below is a portion of a wild-type DNA sequence that encodes the last amino acids of a protein that is 270 amino acids long. The first three bolded base pairs indicate the frame and include the coding region. 5^ ...GCTAAGTATTGCTCAAGATTAGGATGATAAATAACTGG 3^ 3^.. CGATTCATAACGAGTTCTAATCCTACTATTTATTGACC 5^ Which strand is the template strand for transcription of this gene? Briefly explain how you know. An insertion of one base pair causes the protein to decrease in length by seven amino acids. With respect to the sequence given above, where does this insertion occur? A change of one base pair leads to the protein increasing in the length by one amino acid. With respect to the sequence given above, which base pair would you change, and what would you change this base pair for the protein to increase in the length by one amino acid?The following is as segment of mRNA: 5'-UCGGAAUGUGGUGGCAUACAGGCUUACAGAACUAAGUCUGAGAAU-3' A. How many amino acids long will be the protein translated from the only reading frame available in this segment? B. If a mutation changes the third letter of the stop codon in the only reading frame available in this segment, how many amino acids long will be the protein translated?
- How many possible open reading frames (frameswithout stop codons) exist that extend through the following sequence?5′... CTTACAGTTTATTGATACGGAGAAGG...3′3′... GAATGTCAAATAACTATGCCTCTTCC...5'The following DNA nucleotides are found near the end of a bacterial transcription unit. 3′–AGCATACAGCAGACCGTTGGTCTGAAAAAAGCATACA–5′ Q. Draw a diagram of the RNA that will be transcribed from this DNA, including its nucleotide sequence and any secondary structures that form.Here is the sequence of a portion of a bacterial gene. The template strand is on the bottom: 5’- ATGCTGCGTGCATGGGATATAGGTAGCACACGTCC-3’ 3’-TACGACGCACGTACCC TATATCC ATCGTGTGCAGG-5’ (a) Assuming that transcription starts with the first C in the template strand, and continues to the end, what would be the sequence of the mRNA derived from this fragment?
- Here is the sequence of a portion of a bacterial gene. The template strand is on the bottom: 5’-ATGCTGCGTGCATGGGATATAGGTAGCACACGTCC-3’ 3’-TACGACGCACGTACCC TATATCC ATCGTGTGCAGG-5’ Assuming that transcription starts with the first C in the template strand, and continues to the end, what would be the sequence of the mRNA derived from this fragment? Q) Would there be an effect on translation of changing the fourthA in the template strand to a C? If so, what effect?Which of the following set(s) of primers a–d couldyou use to amplify the following target DNA sequence, which is part of the last protein-coding exonof the CFTR gene?5′ GGCTAAGATCTGAATTTTCCGAG ... TTGGGCAATAATGTAGCGCCTT 3′3′ CCGATTCTAGACTTAAAAGGCTC ... AACCCGTTATTACATCGCGGAA 5′a. 5′ GGAAAATTCAGATCTTAG 3′;5′ TGGGCAATAATGTAGCGC 3′b. 5′ GCTAAGATCTGAATTTTC 3′;3′ ACCCGTTATTACATCGCG 5′c. 3′ GATTCTAGACTTAAAGGC 5′;3′ ACCCGTTATTACATCGCG 5′d. 5′ GCTAAGATCTGAATTTTC 3′;5′ TGGGCAATAATGTAGCGC 3′What will be the overall anti-codon sequence in tRNA for this mRNA? 5’-GUAGCCUUAUCUAGCGAUCACCGUCCGUAUUACUAGUGGCCAGACUCUUUUCACCAUGUAUAGUUG-3’
- Consider this sequence below: GAG TAC ACG AGT GGA Which of the following options is an example of a non-synonymous point mutation? (remember to translate to mRNA!) A. GAG TAC AAT CGA GTG GA B. GAG TAC ACG GGT GGA C. GAG TAC A–G AGT GGA D. GAG TAC ACG AGA GGAThe following is part of the non-template strand of DNA for a gene. 5'-TACTATCATGAGAGATAGGAG-3' Which of these sequences corresponds to the mRNA after transcription A)5'-AUGAUAGUACUCUCUAUCCUC-3' B) 5'-TACTATCATGAGAGATAGGAG-3' c) 5'-ATGATAGTACTCTCTATCCTC-3' d) 5'-UACUAUCAUGAGAGAUAGGAG-3' E) N-Tyr-Tyr-His-Glu-Thr-CWhat polypeptide would be produced from the following strand of DNA? The first pair of nucleotides (bolded) contains the start point of transcription. Label the C-terminus and N-terminus ends of the polypeptide. 3’-ATGCCTACGGGTACGCCACTACTCCC-5’ 5’-TACCCATGCCCATGCGGTGATGAGGG-3’