Messenger RNA Codon TableCodonAmino AcidGUGValineCACHistidineCUCLeucineACUThreonineCCUProlineGAGGlutamic AcidPart A: Write the messenger RNA sequences that would be produced from the normal andabnormal DNA sequences shown above.Part B: Using the codon table, write the amino acid sequences produced from the DNA for normaland abnormal hemoglobin.Part C: Beginning with DNA, describe the process that forms proteins such as hemoglobin. Hemoglobin, a protein found in red blood cells, carries oxygen. Abnormal hemoglobin cannotcarry as much oxygen as normal hemoglobin. The sequences below show sections of the DNAsequence that produce both the normal and abnormal types of hemoglobin.Section of Gene for HemoglobinNormal DNA sequence: GGA CTC CTCAbnormal DNA Sequence: GGA CAC CTC

Part A:Messenger RNA sequences produced from the normal and abnormal DNA sequences:Normal DNA…

Answered: Messenger RNA Codon Table Codon Amino…

Biology Today and Tomorrow without Physiology (MindTap Course List)

5th Edition

ISBN:9781305117396

Author:Cecie Starr, Christine Evers, Lisa Starr

Publisher:Cecie Starr, Christine Evers, Lisa Starr

Chapter10: Biotechnology

Section: Chapter Questions

Problem 4SQ

See similar textbooks

Similar questions

Describe how a gene family is produced. Discuss the common and unique features of the members of the globin gene family.Make a drawing. Compare and contrast.
Below is the DNA base sequence for the normal protein for normal hemoglobin and the base sequence for (abnormal) sickle cell hemoglobin: Normal GGG CTT CTT TTT Sickle GGG CAT CTT TTT A)Transcribe and translate the normal and sickle cell DNA. B)Identify this as a point or frameshift mutation. Explain.
Which of the following DNA sequence pairs are completely complementary? Group of answer choices 5’-AGTCTTAGC and 5’-GCTAAGACT 5’-CTGACCTGG and 5’-GGTCCAGTC 5’-TTGATGACC and 5’-TTGATGACC 5’-GAGCTAATA and 5’-GAGCATTAT
Go to the NCBI’s website at https://ncbi.nlm.nih.gov On the database dropdown menu, select “Gene” and search for “RB1.” The first entry should be on the Homo sapiens version; click the gene name. Use the information to answer the following: Go back to the RefSeq (back click once) section in the Gene Database entry for RB1. Click on “NP_000312.2” to access the protein’s amino acid acid sequence information: How many amino acids make up the RB protein? Does this value match your prediction in part d.ii.3? Scroll down to “Features.” List two examples of post-translational modifications that can happen to the RB protein
When forensic experts work with a blood sample, what part of it do they use for PCR; red blood cells, white blood cells, or proteinaceous antibodies? If trying to find a tandem repeat segment, why would you pick one choice other another?
Describe the mutation that created the Hbs allele: type of mutation, location of mutation on HbA sequence (#of bases from beginning of sequence), nucleotide change (from which base to which base?) Answer in a paragraph form and answer it straight forward...
Find the complement DNA sequences to the following DNA sequences:Sequence # 1: GATATAGTSequence # 2: GAGGTTCSequence # 3: AACTAGATSequence # 4: CCTATAAGSequence # 5: AACGTGAT
Write an accurate and precise differential report on the sanger sequencing technique
The illumina method of sequencing uses a unique type of nucleotide building block. What is the specific characteristic of this type of nucleotide that is important for this method of sequencing? How is the sequence of a fragment of DNA determined using this method? (USE THIS LINK AND WRITE ANSWERS IN YOUR LANGUAGE PLEASE DON'T COPY SAME AS GIVEN IN SITE https://www.mybiosource.com/learn/testing-procedures/dna-sequencing/
The following is the base sequence of DNA that codes for first eight amino acids of the β chain of hemoglobin. The β chain of hemoglobin contains a total of 147 amino acids so this is a small part of the entire gene. DNA Template Strand: TACCACGTGGACTGAGGACTCCTC 1. What is the minimum number of DNA nucleotides in this whole gene? 3 2. What is the sequence of bases on the strand of DNA that is complementary to the template strand? 3' TACCACGTGGACTGAGGACTCCTC 5' . 5' ATGGTGCACCTGACTCCTGAGGAG 3' 3. What mRNA will be formed from the template strand of DNA? Sequence of mRNA formed from DNA template strand is shown below: 3' TACCACGTGGACTGAGGACTCCTC 5' . 5'AUGGUGCACCUGACUCCUGAGGAG 3 4. What amino acids will this mRNA code for? 5. If the 20th base in the template strand of the DNA is changed from T to A, rewrite the new template strand below. 6. When the template strand of the DNA is changed, this is referred to as a mutation. What kind of mutation is…
In STR DNA typing, a typical DNA pattern shows (two, three) bands.
Define the following terms:a. DNA typingb. short tandem repeatsc. DNA profiled. ribozymee. noncoding RNA

SEE MORE QUESTIONS

Recommended textbooks for you

Biology Today and Tomorrow without Physiology (Mi…

Biology

ISBN:

9781305117396

Author:

Cecie Starr, Christine Evers, Lisa Starr

Publisher:

Cengage Learning