Q: The 5' end of an mRNA corresponds to the __________ end of a protein. Question 27 options: A) 5'…
A: Biological molecules are those large molecules that are found in the cells of an organism which are…
Q: Examine the diagram carefully, and then answer the question below. VII VII i iv vii VII This diagram…
A: DNA is genetic material which composed of 4 nucleotide ATGC and present in double helix form.
Q: Chargaff's rule applies to: Group of answer choices A. only RNA B. both DNA and RNA C. only DNA…
A: INTRODUCTION chargaff's rule This rule state that the purine and pyrimidine bases of DNA of any…
Q: Use the diagram of a gene below to answer the question. The site of transcription initiation of the…
A: A gene is a sequence of nucleotides in RNA or DNA that encodes for the synthesis of a gene product…
Q: The function of RNA polymerase is to A) catalyze the formation of phosphodiester bonds between…
A: Gene expression is the process thorough which the DNA directs to form proteins. It involves two…
Q: What regulates the process of transcription and translation; compare and contrast these processes.
A: Deoxyribonucleic acid(DNA) is a molecule comprised of two polynucleotide chains coiled around each…
Q: Know the relationship between exons and protein domains.
A: Introduction: Nucleic acid coding segments found in mRNA are known as exons. Non-coding segments in…
Q: Which statement BEST DESCRIBES the genetic code? A. There can only be one codon for multiple amino…
A: 3 nucleotides ( triplet ) formed a single codon . Each codon code for specific amino acid . There…
Q: In Eukaryotes, DNA is a long molecule inside a tiny nucleus. a. How can this long chain fit in such…
A: DNA (deoxyribo nucleic acid) is genetic material of the cell. In case of eukaryotes, DNA is…
Q: How are rare bases incorporated into tRNAs? a. Encoded by guide RNAs b. By chemical changes to one…
A: RNA contains four types of nucleotides adenine, guanine, cytosine, and uracil. In addition to these…
Q: Which best describes the storage of the genetic code? A gene is a segment of DNA, a condensed DNA…
A: Introduction: The mRNA that is present in the cell gets decoded when its nucleotides are read in a…
Q: Queștion 1: The protein Collagen alpha-1 has 1671 amino acids. From start to stop codon, how long…
A:
Q: Use the figure to answer the question. 5' tRNAS , which are single-stranded, have what is described…
A: Introduction :- t-rna (transfer RNA) which is used in translation i.e protien synthesis.Its…
Q: Which description best fits the definition of a messenger RNA? a An RNA that encodes for a protein b…
A: RNA is a single-stranded nucleic acid that aids in protein synthesis in our bodies.
Q: nfer what the result would be if the A site on the ribosome was not in the correct conformation…
A: The biochemical substance that is carried from the preceding generation to the succeeding generation…
Q: Refer to the figure to answer these questions:a. Add labels for mRNA (including the 5′ and 3′ ends)…
A: The central dogma in both prokaryotic and eukaryotic cell comprises of replication of parent…
Q: What happened when a ribosome reaches a stop codon on the mRNA ?
A: DNA is the carrier of genetic information in almost all living organisms except for a few RNA…
Q: Which scenario would NOT cause a change to the amino acid that is added to a polypeptide chain? a.…
A: m RNA codes for proteins. This process is called translation. mutation is change in the DNA…
Q: What is the nitrogen base only in RNA? A C
A: Step 1 Nucleotides are made up of three subunit molecules – nucleobase, pentose sugar, and three…
Q: How many tRNAs must a cell contain
A: In this question, we have to describe number of tRNA must a cell contain.
Q: are changes to the nucleotides in a segment of dna that codes for a protein.
A: Gene mutations are changes to the nucleotides in a segment of dna that codes for a protein.
Q: Use the codon table shown above to help answer this question. What protein sequence would a cell…
A: The mRNA sequence is: 5' CCAUGCACCAAUAGAUAACCG 3' The Codon is read in triplet form.
Q: Define the following terms: a. wobble hypothesis b. aminoacyl-tRNA synthetase c. tRNA d. AUG…
A: Wobble hypothesis was proposed by scientist Crick mainly to explain the observed degeneracy in the…
Q: During protein synthesis, one amino acid binds to RNA molecules. a) What is this RNA molecule? b)…
A: The process of formation of Amino acids from mRNA molecule is known as translation.
Q: Use your genetic code (codon) table to answer the next two questions: What type of mutation would…
A: The answer to the above question is given below.
Q: a. Use the parent strand as a template to synthesize mRNA strand. Describe how the mRNA strand is…
A: Gene expression refers to the process that involves the formation of a functional product of a…
Q: Which is true about eukaryotic cDNA? Choose all that apply a. it is single stranded b. it is made…
A: Complementary DNA is abbreviated as cDNA. This form of DNA has a wide range of applications. Genes…
Q: Transcription is similar to DNA replication because both processes_______ . a. use the same enzyme…
A: Replication and transcription have a lot in common. Watson-Crick base-pairing rules are followed.…
Q: what are the uses of nucleic acids? a-Three things about how nucleic acids are used in cells:…
A: The nucleic acid polymer has nucleotide as its monomeric unit. synthesis of nucleotides is an…
Q: a. Give the sequence of mRNA that would be transcribed off of the bottom strand and label its 5' and…
A: The given DNA, 5'- ATGTCGACGCGCAGGTGA - 3' 3' - TACAGCTGCGCGTCCACT - 5'
Q: ______ molecules deliver amino acids to the site of protein synthesis. a. DNA b. mRNA c. rRNA d.…
A: The process of translation occurs in which proteins are synthesized with the incorporation of amino…
Q: Compare and contrast exons and introns
A: Introduction - Noncoding regions of an RNA transcript or the DNA encoding it that are spliced off…
Q: What is the percentage of cytosine in DNA if the percentage of thymine residues is 28%? A. 22 В. 28…
A: This question can be solved with the help of base pairing rule known as chargaff's rule of DNA base…
Q: 1. Define a chromosome, gene and DNA? 2. Discuss gene expression from transcription to translation.
A: All the organisms on our planet survive due to maintaining metabolic and physiological activity…
Q: Use the diagram of a gene below to answer the question. The site of transcription initiation of the…
A: In the cytoplasm or endoplasmic reticulum, the process in which ribosomes synthesize proteins after…
Q: After transcription, the molecule that is formed is a.complementary to part of one strand of DNA.…
A: Transcription is the process that is catalyzed by the RNA Polymerase enzyme. In this process a…
Q: What is the sequence in the DNA that specifies the codon GCU? Answer with 5’ and 3’ ends labeled.
A: Codons Codons are the triplet form of mRNA which code for specific amino acid. In living organisms…
Q: How many strands of nucleotides is RNA made of? O A. 1 О В. 2 OC. 23 D. 46
A: The genetic material is used to store the genetic information in the mitochondria or nuclei of an…
Q: Define the following terms: a. DNA b. RNA c. genome d. transcription e. fructose
A: All are related to the molecular structure and are biomolecules
Q: how does the E.coli ribosome find the RNA to be translated? A. the sigma factor B. the shine-…
A: SHINE DALGARNO SEQUENCE The ribosome binds to the ribosomal binding site present on messenger RNA in…
Q: Choose the combination of answers that most accurately completes the statement. Which of these…
A: The largest and broadest category of all groups in the classification of life is known as domain. At…
Q: Use the figure of a tRNA to answer the following question: -E D Aminoacyl TRNA adds an amino acid to…
A: RNA is a type of nucleic acid present in the cells.
Q: Speculate why the half-life of mRNA is short, while the half-lives of rRNA and tRNA are long.
A: RNA is a genetic material and basically are of three types rRNA, mRNA and tRNA.
Q: which process releases the DNA into the ionic medium? a. homogenization b. deproteination c.…
A: DNA is a molecule composed of two polynucleotide chains that coil around each other to form a double…
Q: Select the best answer or answers from the choices given: If DNA has a sequence of AAA, then a…
A: The nucleotides are formed by crosslinking three chemicals namely orthophosphoric acid (H3PO4),…
Q: Use your genetic code (codon) table to answer this question: A tRNA has the anticodon GCU. Which…
A: The anticodon of any one tRNA fits impeccably into the mRNA codon that codes for the amino corrosive…
Q: d. Which amino acid is represented by (6)? e. Give the one anticodon in the 5' to 3' direction that…
A: In this question, we are shown the process of protein formation from a DNA sequence. This takes…
How many
a. 12
b. 24
c. 36
d. 48
Trending now
This is a popular solution!
Step by step
Solved in 3 steps
- Which statement BEST DESCRIBES the genetic code? A. There can only be one codon for multiple amino acids. B. There are only 10 different amino acids in proteins. C. More than one codon for a specific amino acid. D. The genetic is misinterpreted to have U instead of T.Why was the cold ethanol added to the soap and salt mixture? A To digest the cell walls B To dissolve the RNA C To emulsify lipids and remove large cellular debris D To precipitate the DNA E To denature the cytoplasmic proteinsWhat is meant by the term DNA replication? a. synthesis of nucleotides b. cell division c. interpretation of the genetic code d. the exact copying of the DNA code into two new molecules
- What is the role of transcription in the determination of the amino acid sequence of a polypeptide chain? A. It pairs anticodons and codons. B. It synthesizes an mRNA strand. C. It duplicates the information in DNA. D. It decodes the information from mRNA.a. Give the sequence of mRNA that would be transcribed off of the bottom strand and label its 5' and 3' ends. b. translate this RNA sequence in 1a into a protein sequence c. Give the sequence of mRNA that would be transcribed off of the top strand and label its 5' and 3' ends. d. Translate this RNA sequence in 1c into a protein sequenceRefer to the figure to answer these questions:a. Add labels for mRNA (including the 5′ and 3′ ends) and tRNA. Inaddition, draw in the RNA polymerase enzyme and the ribosomes,including arrows indicating the direction of movement for each.b. What are the next three amino acids to be added to polypeptide b?c. Fill in the nucleotides in the mRNA complementary to thetemplate DNA strand.d. What is the sequence of the DNA complementary to the templatestrand (as much as can be determined from the figure)?e. Does this figure show the entire polypeptide that this geneencodes? How can you tell?f. What might happen to polypeptide b after its release from theribosome?g. Does this figure depict a prokaryotic or a eukaryotic cell? How canyou tell?
- What do genetic engineers use to create the “sticky ends” needed to splice two fragments of DNA together? a.) an amino acid sequence b.) DNA ligase c.) restriction enzymes d.) mRNAWhich helps prevent errors in DNA replication? A) Complementary base pairing reduce errors B) DNA ligase checks the DNA for errors C) DNA is located in the ribosomes D) Any base can pair with any other baseWhich event contradicts the central dogma of molecular biology? a. Poly-A polymerase enzymes process mRNA in the nucleus. b. Endonuclease enzymes splice out and repair damaged DNA. c. Scientists use reverse transcriptase enzymes to make DNA from RNA. d. Codons specifying amino acids are degenerate and universal.
- Which statement regarding UTRs is TRUE? a) Transcription begins at the start of the 5' UTR b) Translation begins at the start of the 5' UTR c) The 5' and 3' UTRs are spliced from the mRNA transcript d) The translation stop codon is found downstream of the 3' UTRChoose the combination of answers that most accurately completes the statement.The function of ligase is to a. rejoin segments of DNA c. synthesize cDNA b. make longitudinal cuts in DNA d. break down ligamentsWhich is true of the lagging strand in DNA synthesis? a. It is built elongating towards the replication fork b. It is composed entirely of RNA c. It is built in the 3’ to 5’ direction d. It elongates in a series of segments, rather than continuously