Use the diagram of a gene below to answer the question. The site of transcription initiation of the gene is indicated by the arrow. 3' D Which letter in the diagram above best corresponds to the location where a ribosome would bind to start translation?

Use the diagram of a gene below to answer the question. The site of transcription initiation of the gene is indicated by the arrow. 3' D Which letter in the diagram above best corresponds to the location where a ribosome would bind to start translation?

Name: Use the diagram of a gene below to answer the question. The site of t
Uploaded: 2024-03-20T06:42:41.000Z
Channel: Bartleby
Description: Use the diagram of a gene below to answer the question. The site of transcriptioninitiation of the gene is indicated by the arrow.3'DWhich letter in the diagram above best corresponds to the location where aribosome would bind to start translation?N

BIOLOGY:CONCEPTS+APPL.(LOOSELEAF)

10th Edition

ISBN:9781305967359

Author:STARR

Publisher:STARR

Chapter9: From Dna To Protein

Section: Chapter Questions

Problem 16SA

See similar textbooks

Similar questions

Energy that drives translation is provided mainly by ______ . a. ATP c. GTP b. amino acids d. ribosomes
Use the table to answer: A portion of an mRNA attached to a ribosome reads: 5′ GACCAUUUUGACAAAGUUGUAGUGUGGGUAGGGUGA 3′ If a tRNA with a Phe attached is in the P site of the ribosome, an uncharged tRNA will be present in the E site that delivered which amino acid? What is the last amino acid in this polypeptide? Which amino acid will be the most frequent in the polypeptide?
Use the diagram of a gene below to answer the question. The site of transcription initiation is indicated by the arrow. Which letter best corresponds to the location where alternative proteins can be produced from the same gene?
Refer to the figure to answer these questions:a. Add labels for mRNA (including the 5′ and 3′ ends) and tRNA. Inaddition, draw in the RNA polymerase enzyme and the ribosomes,including arrows indicating the direction of movement for each.b. What are the next three amino acids to be added to polypeptide b?c. Fill in the nucleotides in the mRNA complementary to thetemplate DNA strand.d. What is the sequence of the DNA complementary to the templatestrand (as much as can be determined from the figure)?e. Does this figure show the entire polypeptide that this geneencodes? How can you tell?f. What might happen to polypeptide b after its release from theribosome?g. Does this figure depict a prokaryotic or a eukaryotic cell? How canyou tell?
Choose the DNA sequence from which this mRNA sequence wastranscribed: 5′-AUACGAUUA-3′.a. 3′-TATGCTAAT-5′ c. 3′-UAUCGUAAU-5′b. 3′-UTUGCUTTU-5′ d. 3′-CTCAGCTTC-5′
Choose the combination of answers that most accurately completes the statement. Which of these features is found in eukaryotes but not bacteria? a. polygene mRNAs c. stop codon b. introns
In this diagram, the position marked "A" corresponds to the _____ end of a new RNA molecule (shown in yellow) that is being transcribed, base paired with the ______ strand of a DNA molecule (shown in red).
Use the mRNA coding chart above to answer these questions. he following is the base sequence on a portion of a template strand of DNA. 3 ‘ TACGCCAGTGGTTCGCAC 5 Give the base sequence of the complementary DNA strand. Give the base sequence of the strand of mRNA read from the original DNA template strand. List, in order, the amino acids that would be present in this protein? What would be the code that the methionine tRNA anticodon would carry? Suppose a mutation altered the original DNA strand so that the 6th nucleotide was changed to a T. i) How would this change the protein? ii) What type of mutation is this?
Give typing answer with explanation and conclusion to all parts The pairing of the U1 snurp and the donor site signals what particular event? A. Identify the donor splice site. B. Identify/recognize intron. C. Keep the U6 RNA free from binding to the U1 RNA. D. Base pair with the nucleotides in the Branch site. E. De-branch the lariat and release the intron.
Complete the box below: Convert the following template strand of DNA bases into its complementary mRNA molecule. Next translate the DNA into a polypeptide chain of amino acids using the Table above. CAATATGGAAGCCGACTCACCCTAATT
Pick either one of the following to answer: 1) Transcription and translation both involve an initiation, elongation, and termination phase. Describe how each of these phases occurs for both transcription and translation. OR 2) Both transcription and translation involve modifications following the termination step. Describe these modifications and the importance of each modification to complete the final product.
Which is the mRNA molecule that would be transcribed from this DNA template: TGGCAAGTACGT answer choices A.) ACCGUUCAUGCA B.) UCCGUUCUUGCU C.) ACCGTTCATGCA D.) UGGCAAGUACGU