Answered: Use your genetic code (codon) table to…

Name: Use your genetic code (codon) table to answer this question:A tRNA has
Uploaded: 2024-03-20T06:42:41.000Z
Channel: Bartleby
Description: Use your genetic code (codon) table to answer this question:A tRNA has the anticodon GCU. Which amino acid is attached to it?A) alanineB) methionineC) arginineD) threonineE) serine

Science

Biology

Use your genetic code (codon) table to answer this question: A tRNA has the anticodon GCU. Which amino acid is attached to it? A) alanine B) methionine C) arginine D) threonine E) serine

Human Heredity: Principles and Issues (MindTap Course List)

11th Edition

ISBN:9781305251052

Author:Michael Cummings

Publisher:Michael Cummings

Chapter9: Gene Expression And Gene Regulation

Section: Chapter Questions

Problem 4QP: If the genetic code uses triplets, how many different amino acids can be coded by a repeating RNA...

See similar textbooks

Similar questions

A certain mRNA strand has the following nucleotide sequence: 5AUGACGUAUAACUUU3 What is the anticodon for each codon? What is the amino acid sequence of the polypeptide? (Use Figure 13-5 to help answer this question.) Figure 13-5 The genetic code The genetic code specifies all possible combinations of the three bases that compose codons in mRNA. Of the 64 possible codons, 61 specify amino acids (see Figure 3-17 for an explanation of abbreviations). The codon AUG specifies the amino acid methionine and also signals the ribosome to initiate translation (start). Three codonsUAA, UGA, and UAGdo not specify amino acids; they terminate polypeptide synthesis (stop).
If a fragment of nucleic acid has a nucleotide sequence TAC can one assert that it is a codon or an anticodon?
Consider a portion of a gene in a cell with the sequence TTTTT. Which of the following bases would you find in the complementary RNA strand, and where in the (eukaryotic) cell would this RNA be synthesized? A) A-A-A-A-A; ribosome B) U-U-U-U-U; ribosome C) A-A-A-A-A; nucleus D) U-U-U-U-U; nucleus
The nearly universal genetic code consists of how many codons?
Suppose you are provided with a sequence of nucleotides. How would you determine if the sequence is of mRNA, tRNA, or DNA molecules?
Why might there be multiple codons (genetic code triplets) that code for the same amino acid? Why can this redundancy be beneficial to an organism?
Which of the following best describes tRNA? a. Provides the instructions for the amino acid sequence of a polypeptide b. Complexes with ribosomal proteins to form ribosomes c. Used for eukaryotic RNA processing d. Transports amino acids to ribosomes during translation
Why are 3 nucleotides needed for a codon? Because one nucleotide is redundant Because there are 3 different aminoacetyl TRNA synthetase enzymes Because there are 64 amino acids to code for, and 4X4X4 = 64 Because there are 20 amino acids, 3 nucleotides provides enough combinations to code for 20 amino acids
Which amino acid(s) have the most codons? Which amino acid(s) have the fewest codons? Can you think of a reason why multiple codons code for certain amino acids but other amino acids are coded for by very few codons?
Which of the following steps in protein synthesis does not require a direct supply of energy? a. proofreading step by certain aminoacyl-tRNA synthetases b. translocation of mRNA in a ribosome c. linkage of an amino acid to its cognate tRNA d. alignment of a tRNA anticodon with an mRNA codon
Which of the following are stages of translation? Select all that apply. ---A tRNA binds to the second codon and its carried amino acid forms a peptide bond with methionine. ---When the ribosome reaches a stop codon, its subunits detach, and the mRNA and new polypeptide are released. ---As the ribosome moves from codon to codon, amino acids brought by successive tRNAs to the ribosome form a growing polypeptide. ---The binding of a tRNA to the third codon causes the ribosome to release the first tRNA and move to the next codon. ---Ribosomal subunits and a tRNA carrying methionine converge on the start codon of an mRNA.
The template strand of a gene has the sequence 5' CTAGTTGGCACACTCCATGGT 3'. Starting from the start codon, what is the third amino acid incorporated into the polypeptide chain?