Answered: How many restriction sites does each…

How many restriction sites does each enzyme have? Restriction Fragments generated Number of sites Endonuclease by single digest Pstl Нраl Sspl

Biology: The Unity and Diversity of Life (MindTap Course List)

14th Edition

ISBN:9781305073951

Author:Cecie Starr, Ralph Taggart, Christine Evers, Lisa Starr

Publisher:Cecie Starr, Ralph Taggart, Christine Evers, Lisa Starr

Chapter20: Viruses, Bacteria, And Archaea

Section: Chapter Questions

Problem 6SQ

See similar textbooks

Related questions

Q: Why are Bryophytes regarded as "the amphibians of plant kingdom"?

A: Amphibians can be found on both land and water; however, during the breeding season, they must come…

Q: phrases are used.) CODIS The most useful DNA markers for forensics are in the population and do not…

A: The most useful DNA markers for forensics are SSR in the population and do not contribute to…

Q: When is a tetrad specifically formed? Would it be found in a haploid or diploid cell? What event…

A: The "cell cycle", also known as "cell division", is a set of processes that occur in a cell leading…

Q: Decide whether the statement is TRUE OR FALSE. Justify your answer. 1. Introns are coding regions of…

A: 1. Introns are coding regions of the DNA that becomes part of the mature mRNA after splicing.…

Q: What are some of the advantages and disadvantages of utilizing insects as experimental animals in…

A: In various toxicological studies such as in drug toxicity analysis etc. using an insect as an…

Q: 2. In the guinea pig, a locus controlling coat color may be occupied by any of 4 alleles with the…

A: The guinea pig, also known as the domestic guinea pig, is a rodent species in the Caviidae family.…

Q: Subject: Biopharmaceutical technology 1.Identify the types of water that are available and widely…

A: USP (US Pharmacopeia) is a designation that ensures that the water is purified and can be used in…

Q: How many x chromosomes are present in a male skin cell during metaphase?

A: Introduction:- In humans, the X chromosome is one of two sex chromosomes (the other is the Y…

Q: How do mitochondrial proteins interact with IAPs to prevent inhibition of apoptosis?

A: Multicellular organisms experience apoptosis, which is a type of programmed cell death. Cell death…

Q: Think of at least 1 way on how to lower the birth rate in the Philippines. Discuss briefly.

A: Though there are many strategies by which we can lower the birth rates. I am sharing best of two…

Q: numerator and denominator mean in the visual acuity chart

A: Visual Acuity Test It is a series of diagnostic techniques used in the examination of eyes, the…

Q: Calculate the CFU/mL of the original culture for the countable plate as shown in the diagram. b) How…

A: Introduction :- CFU( colony forming units ) are the count of cells present in orginal culture which…

Q: List common modes of reproduction in Algae?

A: Reproduction can serve two distinct purposes. The two distinct purposes of reproduction are…

Q: Please define the term niche, and describe the many roles microbes fulfill in an ecosystem.

A: The niche of an organism is the purposeful function that it performs inside an environment. The area…

Q: Which are the effects of insulin on adipocytes? Inhibits gluconeogenesis Inhibits lipolysis…

A: Introduction Insulin is a peptide hormone that is produced by beta cells in the pancreatic islets…

Q: explain about the genetic drift -differentiate founder effect from bottleneck effect.

A: Evolution is a steady phenomenon which bring about transformation of life from much simple one to…

Q: PROCEDURE 1 Time to Trace! In this procedure, you will be tracing two invaders: bacteria in the…

A: Bacteria are microscopic, single-celled organisms that exist in their millions, in every…

Q: Now consider alanine as a whole molecule. Use the Ka values from the chart above, and your…

A: For alanine, the pKa1 value is 2.35 the plan value is 9.87 The isolectric point is the pH at which…

Q: Adjusting the objective aperture is an important step to obtain phase contrast in TEM. Compare the…

A: The "objective aperture" is used for accepting a transmitted wave or one of diffracted waves to…

Q: What is Binomial system of nomenclature? Who proposed this system? Why is binomial nomenclature the…

A: Binomial Nomenclature Carolus Linnaeus in the 1750s gave the formal naming system to organisms…

Q: If a population is experiencing directional selection with respect to wing color, what type of…

A: Natural selection drives the process of evolution.

Q: Which molecules, or function groups, or complexes that may be responsible for the absorbance at 595…

A: Spectrophotometry applications are useful to measure the absorbance, reflectance, and transmission…

Q: - research and explain about the genetic drift -differentiate founder effect from bottleneck…

A: Introduction Evolution:- Evolution is a process of gradual change in the characteristics of a…

Q: The genes that codes for the creation of certain blood groups are located on chromosome "XGp22.3",…

A: *Chromosomes can be found in nucleus which are thread like structures located present in both…

Q: Splicing regulatory (SR) proteins bind at exon to recruit U1snRNP and U2 snRNP during RNA splicing.…

A: There are few important points about splicing apparatus are as follows: The central component of…

Q: Are gender traits completely a result of societal expectations?

A: The answer is NO. It's not true always.

Q: 3. How is population growth depicted? 4. What are the applications of knowing limits to population…

A: Ecosystems provide foods, medicines, and energy, they regulate nutrient recycling and waste, they…

Q: what are the fundamental steps in canning?

A: The history of canning begins when Napoleon promised money to devise a way of preserving food during…

Q: How does the process of DNA replication generate mismatch mutations? What mechanisms are available…

A: DNA replication is the process in which dsDNA is copied to produce two identical DNA molecules.

Q: Explain sexual reproduction in bacteria?

A: Despite the fact that bacteria do not have true sexual reproduction, they exhibit genetic…

Q: Worthiness of development 5= very worthy, 1= not worthy at all 5 4 3 2 1 Aspects Reasons Agriculture…

A: Genetic engineering, often known as genetic modifications, is the use of molecular techniques to…

Q: Give 3 examples each on plant and animal hybrid species and provide details on parental species, the…

A: Hybridization is the technique of mixing complementary single-stranded DNA or RNA molecules and…

Q: A critique is a genre of academic writing that briefly summarizes and critically evaluates a work or…

A: Critique analysis is evaluation of text, it is subjective writing. The purpose of critique is to…

Q: Explain how the diameter of skeletal muscle fibers varies and what type of muscle tissue grows as…

A: A single muscle cell is made up of muscular fibres. They help in the control of the body's physical…

Q: Consider a person without any functioning plasma cells. What effects would this condition have on…

A: Plasma cells are round or ovoid cells that contain colored cytoplasm with a pale perinuclear area of…

Q: 9. For stabilization of disturbed brain functions in mental disease nootropic agents are widely used…

Q: Which of the following is true about Liebig's Law of the Minimum? A. The growth of a plant is not…

A: Justus von Liebig popularised Liebig's law of the minimum, also known as Liebig's law or the law of…

Q: Which is not a function of bone? O energy storage O movement O mineral storage O protection O…

A: Bone is a connective tissue that helps in formation of body's skeleton. There are three types of…

Q: When the anticodon on a tRNA is "ICG, all of the following codons except can pair with this…

A: Some tRNA anticodon loops contain inosine (I) which allows recognition of multiple codons through…

Q: List some applications of DNA fingerprinting.

A: The DNA of every human on the planets is 99.9% the same. However 0.1 percentage of the DNA is unique…

Q: 9. Two varieties of pumpkin with different weights were crossed: 5 lb. and 29 lb. 3/195 of the F2…

A: The answers attached below.

Q: In addition to anaerobic bacteria which other two examples did the narrator state that anaerobic…

A: Here I will give the two other conditions or states of anaerobic conditions.

Q: Which of the following is true of reverse transcriptase?a. It is required for the movement of DNA…

A: The enzyme engaged in reverse transcription is reverse transcriptase. The enzyme works through using…

Q: According to Wallace and Darwin, for new individuals to emerge, a group of individuals must become?…

A: Evolution is process in which new organisms develop or evolve into new organisms over a period of…

Q: Describe the cerebrum, cerebellum, and spinal cord's white and gray matter areas. Include the…

A: Cerebrum is the largest part of our brain, it is a part of forebrain. It is related to the…

Q: Which of the following diseases is/are associated with "Biofilms'

A: Biofilm can be defined as a polymer encased community of microbes(bacteria) that accumulates at a…

Q: Location/enzyme DNA Process RNA polymerase Transcription RNA transcript Ribosome Protein Translation

A: Nucleus is a main controller of the cell which carriers genetic instructions . It consists of…

Q: mechanisms of locomotion that this organism can have?

A: 1.They move by using their muscles to push their scales against the ground

Q: following data could the man be the father of the 3 children? please write complete answer and…

A: * Given that father has genotype Dce/DcE/Ms/NS this is 0 type blood group. * Mother has genotype…

Q: I1. Electrical impulses in muscle fibers are called 12. Groups of muscle fibers are that are…

A: The movement of skeleton muscles is voluntary in nature and regulated by central nervous system.…

Concept explainers

Sleep Physiology

Sleep is a condition of reduced muscle movement in the body. Awareness about the surroundings is reduced at the time of sleep. The body stays mildly responsive or non-responsive to external stimuli. The sleep-wake cycle is controlled by the circadian rhythm that produces a resting phase for the body.

Question

Need in short and ASAP

5. How many restriction sites does each enzyme have?
Restriction
Fragments generated
Number of sites
Endonuclease
Pstl
by single digest
Нраl
Sspl

Expert Solution

This question has been solved!

Explore an expertly crafted, step-by-step solution for a thorough understanding of key concepts.

SEE SOLUTION Check out a sample Q&A here

Step 1

VIEW

Step 2

VIEW

Step by step

Solved in 2 steps with 2 images

SEE SOLUTION Check out a sample Q&A here

Knowledge Booster

Learn more about

Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.

Similar questions

1 Restriction enzymes cut DNA molecules atspecific locations to produce restriction fragments witheither blunt or _______ ends
1. Write if the statement is true and modify the statement with the correct answer if its false a.White colonies represent those bacteria that do not express the genes for beta-galactosidase because restriction enzymes have cut the gene and ligase have not repaired the break b.Antibiotic resistance genes in bacterial transformation are used as marker genes because of ease of detection of transformants. c. Bacterial transformation simply means the insertion of a recombinant plasmid into a bacterial cell.
Bacteriophages kill their host quickly by ______ . a. binary fission b. a lytic pathway c. a lysogenic pathway d. transformation
#2 EcoRI --- 5’ G ↓AATTC 3’ 5’ ACG ACGTATTAGAATTCTTA TCCGCCGCCGGAATTCT CATCA 3’ 3’ TGC TGCATAATCTTAAGAATAGGCGGCGGCCTTAAGAGTAGT 5’ Restriction enzyme: Recognition sequence: Number of pieces of DNA: Type of cut:
DRAW IT The restriction enzyme HindIII recognizes the sequence5¿-AAGCTT-3¿, cutting between the two A’s. Draw the double-strandedsequence before and after the enzyme cuts it.
The recognition site of some restriction enzymes are shown. Which will produce sticky ends? A. EcoRI G↓AATTC. B. SmaI CCC↓GGG. C. XhoI C↓TCGAG. D. Both EcoRI and XhoI. E. All the enzymes shown will leave sticky ends.
Microbiology q you introduced mutations into bacteria. However, the bacteria have the same characteristics as before. What kind of mutations do the bacteria have? O base deletion Oframeshift O missense O silent O nonsense
Part 3. Restriction Enzymes 1) Consider the sequence of DNA given below and answer the following questions 5’ ATTGAGGATCCGTAATGTGTCCTGATCACGCTCCACG 3’ 3’ TAACTCCTAGGCATTACACAGGACTAGTGCGAGGTGC 5’ a) You cut the sequence of DNA shown above using BamHI (see table 19.1 from the text). How many fragments of DNA would you expect to result from this restriction digest? b) If you cut the sequence of DNA shown above using BclI (recognition sequence = 5’ TGATCA 3’, enzyme cuts after the first T) instead of BamHI how many fragments do you expect? 2) For each given sequence/restriction enzyme pair, determine how many pieces of DNA would result form the digest and indicate whether those pieces would have blunt or sticky ends. NOTE: in the given recognition sites, the dash represents where the cut is made. a) HpaI, recognizes 5’ GTT – AAC 3’ 5’ GGATGTTAACAATCTCTACGGGTTAACACCCTTGGGTTAACATCCGCGG 3’ 3’ CCTACAATTGTTAGAGATGCCCAATTGTGGGAACCCAATTGTAGGCGCC 5’ Number of fragments of DNA:…
1. What are the function, structure (substrate, cofactor, apoenzyme etc.), and major tissue source/organ of new born screening enzyme.
1. (a) Restriction sites are usually ______. Recombinant DNA Technology Restriction enzymes Ligase Palindromic sequences (b) Involves joining a donor DNA fragment of interest to a vector Recombinant DNA Technology Restriction enzymes Ligase Palindromic sequences
why the bacteria synthesize Restriction endonucleases enzymes. What’s themain purpose and how the bacteria protect itself from these enzymes
1. Scientists were able to develop transgenic bacteria that can be used for mercury remediation. This process involved combining genes for mercury resistance (so that the bacteria itself has protection) and mercury accumulation (thereby allowing the bacteria to sequester Hg for retrieval later on). They probably used the following techniques in creating the transgenic bacteria EXCEPT a. plasmids b. DNA ligase c. DNA polymerase d. restriction enzymes 2. Consider these two parents (Mom and Dad) and their son, Calvin. (see pic attached). Which two members of this family would show the greatest difference in their DNA profile?