Huntington's disease in regards to Trinucleotide repeats give detailed reponses provide exmaples
Q: peptide bond formation is catalizyed at the larger ribosomal subunit. does this happend in…
A: Translation includes three phases: initiation, elongation, and termination. Initiation is a phase in…
Q: Briefly explain the importance of the protein factor EF-Ts in the translation process. Do not simply…
A: After the process of transcription of DNA to RNA in the nucleus of the cell, ribosomes in the…
Q: The function of transposase isa. to recognize inverted repeats.b. to remove a TE from its original…
A: A gene is a specific sequence of nucleotides in RNA or DNA that is located usually on a chromosome.…
Q: MRNA CODONS RESPONSIBLE FOR LINING UP EACH OF THE 20 AMINO ACIDS Amino Acid Code-End of the MRNA…
A: The translation is a process in which the genetic information in the mRNA strand is converted into…
Q: Briefly explain the importance of the 5'-cap in the translation process. Do not simply define the…
A: Introduction :- During transcription, the 5' cap is inserted to the first nucleotide in the…
Q: Given this MRNA strand: 3 - AUGAGGAAGGUA - 5"; what are the components of the polypeptide?
A: The polypeptide is formed by decoding the triplet codons using the codon table given. The mRNA…
Q: Give the codonfor methionine.
A: Proteins are macromolecules formed by long chain of amino acids. They are involved in a vast array…
Q: Given this mRNA strand: 3’ - AUGAGGAAGGUA - 5’; what are the components of the polypeptide?
A: Translation is the process in which the genetic message carried by mRNA from the DNA is converted in…
Q: Describe the Okazaki fragment and its formation in one of the strands of DNA essentiality of their…
A: Only while each strand of DNA is separated from an additional can DNA polymerase activity continue…
Q: There are three termination codons (UAA, UAG, UGA) but usually only one initiation codon (AUG) is…
A: The initiation codon is also referred to as start codon which marks the beginning of the translation…
Q: The RNA polymerase from bacteriophage T7 diff ers structurally from prokaryotic and eukaryotic RNAPs…
A: T7 RNA polymerase shares extensive sequence similarity with mitochondrial and chloroplast RNA…
Q: xplain The mRNA codon of valine is: GUC UGG CCA TTG
A: Each codon in mRNA is made up of three nucleotides and represents a certain amino acid (hence, it is…
Q: 1b) Give the anticodon of the tRNA that would be complementary or a perfect match to the codon…
A: The codon is defined as a sequence of three nucleotide bases on messenger RNA responsible for…
Q: The genetic code is both universal and degenerate. Explain how these aspects are an advantage, but…
A: Proteins are made up of amino acids encoded by codons. Each codon consist of three nucleotide which…
Q: ATCGTCA AGGCCTA ATCTCAA AGGCCT A Original Strand Mutant Strand Types of Mutation Explain/Why
A: Mutation:- Any alteration in the sequence of DNA that results in altered function or non-functional…
Q: . A mutational lesion results in a sequence containing amismatched base pair:5′ AGCTGCCTT 3′3′…
A: Mismatch repair : It is a system for recognizing and repairing wrong insertions, deletions and…
Q: Some enzymes are considered as molecular scissors. in genetic engenrring. What is the name assigned…
A: Genetic engineering is a process by which the genetic makeup of an organism can be altered. This…
Q: most STR fragments used in human forensic analysis are comprised of_____ repeats
A: STR Stands for short tandem repeats, these are short sequences in DNA that make large subunits…
Q: Question 50 The presence of non-Watson base pair
A: A DNA repair mechanism is a group of processes that helps to correct the faulty or damaged DNA. This…
Q: The enzyme thiouridylase converts certain tRNA uridine residues to 2-thiouridine. Draw the structure…
A: Enzyme is a catalytic molecule that increases the rate of any chemical reaction without being used…
Q: Explain the mechanism of trinucleotide repeat expansion.
A: Introduction: A trinucleotide repeat expansion is type of DNA mutation. In which, the trinucleotide…
Q: briefly explain the importance of the degeneracy of the genetic code in the translation process.
A: The genetic code can be defined as a collection of rules that living cells use to translate…
Q: Why do you think this substituion is named " NonSense". In your response explain what it means to…
A: Mutation Mutation is the error in DNA. When a single base or more than one bases are change in the…
Q: The transcriptional complement of the DNA strand with the code 3’ TAA-CAT-GCT 5’ is
A: Introduction :- A region of DNA opens up during transcription. One strand, known as the template…
Q: Some RNA molecules are covalently modifi ed by methylation at the N6 position in adenosine residues.…
A: Methylation of DNA is a process of covalent modification, in which at the adenosine nitrogenous…
Q: The oxidation of guanine bases in the context of triplet repeats such as CAGCAGCAG can lead to the…
A: The triplet repeat is called reiteration disorder. The increase in copy number of the triplet repeat…
Q: pc*00ATAAADDATATAJOTTAA 1. Use the genetic code table and the information in the diagram below to…
A: Gene is a part of the DNA, located on a specific site on the chromosome and has a specific sequence…
Q: Any RNA polymerase in any organism: OA Synthesizes RNA chains in the 3' to-5 direction O B. Binds…
A: A gene is a functioning heredity unit made up of DNA that provides instructions for the creation of…
Q: code, indicate which polypeptides would be synthesized if poly-UGG were used in a s G
A: Poly-V indicates valine Poly-G indicates Glycine Ploy-W indicates Tryptophan Poly-Y indicates…
Q: replication, resulting in a (e) Errors may change to the sequence of base triplets. Explain how a…
A: Ans- Errors that arise during the DNA replication because of the change in sequence of gene triplets…
Q: Assume that the translational error frequency, 8, is 1 × 10-4. (a) Calculate the probability of…
A: The translation is the process of making a polypeptide chain from mRNA. The translation is catalyzed…
Q: Under physiological conditions, DNA ordinarily formsB-DNA. However, RNA hairpins and DNA-RNAhybrids…
A: DNA and RNA are the biomolecules that are responsible for carrying genetic information in all living…
Q: Given the sequence of triplet codons: 5′-TAC AAA ATA CAG CGG-3′, write out one of each: transition;…
A: Transition mutation refers to a point mutation that changes a purine nucleotide to another purine (A…
Q: Using the provided čoding strand below 5-ATCAGATGGCCGGGCCAATAGAATAGCTGT-3 Provide the anticodons…
A: DNA is two stranded ladder like structure which comprises of :- A) Coding strand B) Template…
Q: 8 QUESTION: Transcribe the gene. Write out the correct sequence of mRNA bases. Notice that this is…
A: Transcription is the synthesis of RNA from DNA segment with the help of RNA polymerase enzyme. It…
Q: IK Comans Caselm) are shOwn in the following document: Codon Number Base Sequence of Normal DNA…
A: The base sequence of a normally transcribed strand is given as follows, TAC TCC CTC AAT CTT AAT TTG…
Q: Bloom syndrome in regards to faulty DNA give detailed reponses provide exmaples
A: Genetic diseases are diseases that are caused by abnormalities in genes. Autosomal disorders are…
Q: Huntington's Disease is an autosomal dominant disorder caused by trinucleotide repeat expansion.…
A: Huntington's disease is an autosomal dominant disease. It is caused by trinucleotide (CAG) repeat…
Q: Variable number tandem repeats (VNTRs) are repeating DNA sequences of about 15–100 bp in length,…
A: Forensic science. Criminological science is the use of science to criminal and common laws,…
Q: 32.) Translate the following mRNA into protein primary structure. Use the ONE-LETTER abbreviations…
A: Note: You have asked multiple independent questions and thus we have solved the first question for…
Q: How the conformational changes impact its affinity for the target DNAsequence ?
A: Introduction Protein is the key biomolecule in the biological system, any important physiological…
Q: DNA Structure Provide a detailed (hand-drawn) structure of the double-stranded DNA GGATCC
A: DNA is a nucleic acid. DNA is polymer of nucleotides. Nucleotide is composed of pentose sugar,…
Q: Would you expect to find nuclear localization sequences(NLSs) in the proteins that make up…
A: A nuclear localization sequence is an amino acid sequence that aids in protein transport (import)…
Q: The enzyme dihydrofolate oxidase has 3 adjacent asparagines residues (codon for asparagines is ACC):…
A: Site directed mutagenesis can be defined as the method to perform certain changes in the double…
Q: Describe Information Transfr Replicetion - Transcuiption Tronslation
A: Genes and genomes play an important role in information processing. The genetic material of the cell…
Q: Replicate this sense strand to create a double-stranded DNA helix…
A: DNA is the store house of general characteristic. The specific sequence of 4 bases in the DNA…
Q: Define simple sequence repeats (SSRs)
A: The microsatellites that stretch DNA is known as Simple Sequence Repeats (SSRs). They are also…
Q: In prokaryotes, a search for genes in a DNA sequenceinvolves scanning the DNA sequence for long…
A: The prokaryotic and the eukaryotic are the two different types of cells. The prokaryotic cells are…
Huntington's disease in regards to Trinucleotide repeats
give detailed reponses
provide exmaples
Step by step
Solved in 3 steps
- This is a missense mutation explain. Include the ideas of translation and transcription. Compare the normal and abnormal strands.a) Replicate this sense strand to create a double-stranded DNA helix TGAGGATGAAACTCACACCGGGGCGCAGTTTGGCACTTAGATTCTTGTACACGACCTAGTATAACACAGTT b) Using this DNA double helix, express the gene – i.e. determine the resulting polypeptide sequence by using the correct reading frame. When you get to the stop codon – you may write an asterisk (i.e. a “*”) to denote the stop codon. c) Does the sense strand DNA sequence have 5’ and 3’ UTR sequences? If so – write them in the space below 5’ UTR: 3’ UTR:Define simple sequence repeats (SSRs)
- Here is a DNA coding strand’s sequence and direction: 5’-ATGCCGATATAG-3’ . What would be the amino acid sequence in the polypeptide encoded by this DNA?PLEASE FL OUT TABLE USING INSTRXUTIONS -USE BASE PAIRING RULES TO COMPLETE SECOND COLUMN FOR EACH MUTATION WRIYE IN ANY MRNA DOEONS RHAT WILL BE FHANGED AS THE REEULR OF RHE MURATION AND USE X MARKS RO INDÍCATE DOONS THAT WONT BE FHANGES CIRCLE STOP CODONSGiven this sequence ATGCACCG About how often (every _____ bases) would this occur in double strand DNA that is known to contain 20%T. Show work.