I. During the past few decades, researchers have been using the 16S rRNA gene, which is a specific gene that is universally carried by all bacteria, to reveal the phylogenetic identities of bacteria. What does the small letter "r" in the "16S rRNA gene" stand for? Use one word to answer the question.

I. During the past few decades, researchers have been using the 16S rRNA gene, which is a specific gene that is universally carried by all bacteria, to reveal the phylogenetic identities of bacteria. What does the small letter "r" in the "16S rRNA gene" stand for? Use one word to answer the question.

Biology: The Dynamic Science (MindTap Course List)

4th Edition

ISBN:9781305389892

Author:Peter J. Russell, Paul E. Hertz, Beverly McMillan

Publisher:Peter J. Russell, Paul E. Hertz, Beverly McMillan

Chapter14: Dna Structure And Replication

Section: Chapter Questions

Problem 15TYK: Design an Experiment Design an experiment using radioactive isotopes to show that the process of...

See similar textbooks

Similar questions

Which of the following sequences on a DNA molecule would be complementary to GCTTATAT? TAGGCGCG ATCCGCGC CGAATATA TGCCTCTC
Three different bacteria species have the following consensus sequences upstream of a conserved gene. Species A Species B Species C -10 TAATAAT TTTAAT TATATT -35 TTGACA TTGGCC TTGAAA Table 15.2 Order the bacteria from most to least efficient initiation of gene transcription. A > B > C B > C > A C > B > A A > C > B
Design an Experiment Design an experiment using radioactive isotopes to show that the process of bacterial transformation involves DNA and not protein.
A scientist sequencing itiRNA identifies the following strand: CUAUGUGUCGUAACAGCCGAUGACCCG What is the sequence of the amino acid chain this itiRNA makes when it is translated?
Give the RNA molecule sequence transcribed from the following DNA sequence of a eukaryotic gene and with the correct 5' and 3' ends. DNA: 5'-ATAGGGCATGT-3' 3'-TATCCCGTACA-5' <--- template strand Group of answer choices 5'-ATAGGGCATGT-3' 3'-UAUCCCGUACA-5' 5'-AUAGGGCAUGU-3' 3'-TATCCCGTACA-5'
The sequence of the coding strand of a bacterial gene is given below. The positions of the first nine bases are numbered for your convenience. A missense mutation was introduced at position seven where the C was changed to a T resulting a mutant gene. 123456789 5'- ATGGCCCGACCGCAACTTTTCCGAGCTCTGGTGTCTGCGCAGTGACC-3 a. Write the template DNA (complementary strand) sequence for the wild type gene above b. Write the DNA sequence of the mutant gene (Both DNA strands) c. Write the sequence of mRNA produced from the mutant gene d. Write the sequence of the mutant protein using the codon usage table provided in the end of this document.
1. Classify the type of mutation that have taken place: silent, missense and nonsense as a result of a single base substitution from UCG codon which codes for cysteine:a) AGC (ser): ________b) UGU (cys): ________c) GGC (gly): _______d) UGA (stop): _______e) UUC (phen): _______2. A single base addition and a single base deletion approximately 15 bases apart in the mRNA specifying the protein lysozyme from the bacterial virus T4 caused a change in the protein fromits wil-type composition….lys-ser-pro-ser-leu-asn-ala-ala-lys…..to the mutant form lys-val-his-his-leu-met-ala-alalys.a. Decipher the segment of mRNA for both the original protein and the double mutant.b. Which base was added? Which was deleted?3. Given is the 30 nucleotides in the human gene for hemoglobin (the oxygen-carrying protein in the red blood cells): 5’ TAC-CAC-GTG-GAC-TGA-GGA-CTC-CTC-TTC-AGA 3’a. What is the complementary strand?b. Deduce the mRNA in this coding region.c. What is the amino acid sequence based on this…
35) A researcher inserted DNA fragments from an organism into expression vector plasmids and introduced the modified plasmids into bacterial cells. Which of the following methods would be an effective means of identifying which clones contain a specific gene of interest?
Here is the sequence of a portion of a bacterial gene. The template strand is on the bottom: 5’-ATGCTGCGTGCATGGGATATAGGTAGCACACGTCC-3’ 3’-TACGACGCACGTACCC TATATCC ATCGTGTGCAGG-5’ Would there be an effect on translation of changing the fourthA in the template strand to a C? If so, what effect?
asap please A partially filled diagram of eukaryotic gene structure is shown below. Label the following additional elements in the empty boxes. One label must be used twice: a) 3'UTR, b) 5'UTR, c) exon, d) intron, e) promoter
A small section of bacterial DNA template (antisense) strand has the following nucleotide sequence: CGA AAA GAG AAT A mutation in the above sequence involved a substitution of a single base, resulting in an incomplete protein due to a nonsense mutation. Which of the following gen sequences exemplifies the mutation described above? a. CGA UAA GAG AAT b. CGA AAA AAG AAT c. CGA AAA GAG ACT d. UGA AAA GAG AAT
1.) A portion of a strand of a much longer molecule has a nucleotide sequence AGC – AGG – CAG - ATC, if this strand is replicated, what will be its complimentary strand? a.)TCG – TCC – GTC - TAG b.)AGC - AGG – CAG - AUC c.)AGC – AGG – CAG - ATC b.)UCG – UCC – GUC – UAG 2.)If the environment gets cold, we often shiver to____ a.)decrease body temperature b.)keep body temperature the same as the external temperature c.)regulate blood pressure d.)increase body temperature 3.)How does a neuron transmit a message from cell to cell? A nerve impulse travel_ a.)from the end of the axon, through the cell body up to the dendrite’s terminal, then across the synapse to the axon of another neuron b.)from the dendrites of one neuron to the dendrites of another neuron passing the cell body to the synapse of the axon c.)from the end of dendrite, through the cell body, down the axon terminals, then travels across the synapse to the dendrite of another neuron d.)from the axon of one neuron to the…