Identify the sequence of the peptide below. H CH2 CH, H,N*-CH-C-N-CH-C-N-CH-C-N-CH-C-N-CH-C-N-CH-C-N-CH-COOH H CH, Нн H CH, CH, CH, CH, *NH, CH2 H CH, H CH2 2. ÇH, ČOOH SH S ČH,

Q: Peptide bond structure is planar and has considerable double bond character permitting rotation…

A: The bond that connects the aminoacids is called Peptide bond. It is formed by dehydration Synthesis…

Q: Write down the abbreviations (both 1 letter and 3 letter) for the amino acids given below:…

A: Amino acids contain an alpha-carboxylic acid group and an alpha-amino group. Glycine is the simplest…

Q: List two types of DNA mutations and state which one is more likely to have a severe effect on the…

A: DNA mutations are a sudden change in the DNA sequence. Mutations can be caused by various factors,…

Q: In hemoglobin (above), which level of protein organization includes the peptide bonds, hydrogen…

A: Proteins are classified on the basis of their increasing complexity and structure. Every protein…

Q: Reveal the secret message by writing the amino acid sequence into one-letter code: Leu-…

A: Biomolecules are organic molecules made up of mainly carbon and hydrogen but there are other…

Q: When answering the questions below, please use the one-letter code for the amino acid, with NO…

A: Acid hydrolysis: Acid hydrolysis of any protein/polypeptide is being used to detect amino acids…

Q: H,Ñ-CH-C–NH-CH-C-NH-CH-C-0 CH, CH-CH; СНОН CH, ČH; ČH;

A: The given peptide is composed of three amino acids; it can also be called tripeptide. The sequence…

Q: Answer the below questions based on the following peptide sequence:…

A: Hi! Thanks for your question. The first and the last question will have the same explanation.…

Q: what is the net charge on the peptide at PH=6? NH2-Glu-Lys-Leu-Ser-Cys-Arg-COOH

A: The net charge on a peptide is determined by comparing the pH and pKa values of the amino acid.…

Q: A sample of an unknown peptide was divided into two aliquots.  One aliquot was treated with trypsin,…

A: Proteolytic cleavage is basically the process of breaking the peptide bonds between amino acids in…

Q: A sample of a peptide of unknown sequencewas treated with trypsin; another sample of the same…

A: Introduction: The chain of amino acids is known as a peptide which is connected by an amine or…

Q: fof NH HO-P-O-P-O-F `NH2 ÓH ÓH OH OH OH Which nucleotide is shown in the picture above?

A: A nucleotide is a molecule that is organic, containing a nucleoside and a phosphate. It is the basic…

Q: Modify the amino acid by adding or removing atoms or bonds and by adding charges where appropriate.…

A: Note : Hi ! Thank you for the question. We are authorized to answer one question at a time. Since…

Q: The peptide below is placed into a buffer with a pH = 6.65 HN-CH- CH3 NH-CH- NH-CH -NH -NH-CH- OH…

A: An amino acid's zwitterion exists at pH = isoelectric point. Each amino acid has a unique pI value…

Q: L--L--F--A--I--A--M--F--L--N--I--A--I--A--I What do you think will happen if large concentrations…

A: The given peptide is L--L--F--A--I--A--M--F--L--N--I--A--I--A--I.

Q: Match the function with the appropriate protein or sequence:

A: tRNA is a short nucleotide chain with L-shaped structure. A tRNA molecule is required for…

Q: Which letter corresponds to the answer? The L-configuration of this amino acid is important for the…

A: Amino acids are organic molecules having an amino group and an acid group. Amino acids are…

Q: 1. Assign IUPAC names to each of the following small peptides. a. Gly-Ala-Leu b. Gly-Tyr-Ser-Ser C.…

A: As a general rule of writing peptides, the N-terminal is at the left and the C terminal is at the…

Q: Identify the amino acid shown below. (Note: single letter code is provided as answer) H. H,N-C-COOH…

A: Amino acids are chemical molecules that combine to produce proteins and are hence known as building…

Q: H₂N H H₂C 0 a. Peptide bonds b. N terminal (name) C. C terminal (name) OH

A: Proteins are composed of amino acids. They are linked together by peptide linkages. Proteins have…

Q: Which of the following peptides will likely form an irregular structure? A-D-I-E-L-Y-F-H-I-C-V-D-E…

A: The key to perfect structure of peptides is amino acids  Irregular peptide structure don't form…

Q: Refer to the accompanying figure to answer the following question(s). R R EN-C-C-N-C-C-O-H H H А. В.…

A: Q. At which bond would water need to be added to achieve hydrolysis of the peptide, back to its…

Q: Identify the biomolecule and label and name the functional groups you can identify

A: A biomolecule is a carbon-based organic compound and they are produced by living organisms. Commonly…

Q: Which amino acid is NOT associated with the oligopeptide given by the shorthand notation GRFAV?…

A: Biological macromolecules are those large molecules that are necessary for the survival and growth…

Q: Name each amino acid below with only their full name and the three-lever abbreviation. Submit your…

A: Amino acids are building blocks of proteins. They are 20 standard amino acids that are classified…

Q: Identify the amino acid. OH 0=C H2 CH-C H2 -CNH2 NH2

A: Amino acids are the monomers that build polymers called proteins. The amino acids are linked…

Q: HN-CH- HN-ÇH-C- -OH HN- CH 1 2 3.

A: Each amino acid has a N-terminal (-NH2 group), a C-terminal (-COOH group) & a R-group or the…

Q: Which of the following peptides will likely adopt an alpha helix structure? (idk)…

A: α-helix is a secondary structure of protein in which the polypeptide chain twists to form a helical…

Q: The amino acid arginine ionizes according to the following scheme: NH, NH2 NH2 H NH, C=N C=N C=N…

A: All amino acids contain atleast two ionizable groups-alpha main and the carboxyl group. Some amino…

Q: This macromolecule is readily available and used extensively.The molecule below is a H-C-O HHHH H H…

A: Answer : Option (4) is correct. - triglyceride.

Q: What products are formed when below peptide is treated with chymotrypsin? Phe–Tyr–Gly–Cys–Arg–Ser

A: Three different types of bonds occur in the formation of polymeric biomolecules – peptide,…

Q: How do you differentiate the amino acid peptides given below?? Peptide 1: E-R-G Peptide 2:…

A: Amino acid are one type of organic molecules that contains amino(Nh) and carboxyl (cooh) terminal…

Q: For the three peptides below, label whether they would form an amphiphilic beta-strand, amphiphilic…

A: Amphipathic beta-strand: The amphipathic beta-strands consist of a 1-3 amino acid pattern of…

Q: Peptide 1: VALKTQAM Peptide 2: LDGKM Peptide 3: TQAM Peptide 4: LDGK Peptide 5: MVALK The sequence…

A: For determination of which of the 20 possible amino acids are present in a particular protein, and…

Q: Define the following terms:a. polypeptideb. peptidec. proteind. peptide bonde. standard amino acids

A: Note: Since you have posted a question with multiple subparts, we will solve the first three…

Q: A polypeptide is subjected to the following digestion procedures and the fragments are sequenced.…

A: For this question we just need to to know sites of Trypsin and Cynogen Bromide at which they act and…

Q: Translate the following DNA sequence into amino acids 5'ATAGTACCGCAAATTTATCGCT3' O…

A: Answer :-                             Met-ala-phe-lys-stop                  DNA…

Q: Match the protein structure terms on the left with the descriptions on the right. v(Choose) commonly…

A: Proteins are the unbranched polymer of amino acids. There are four level of structural organization…

Q: The amino acids are leucine, serine, aspartic acid, and lysine.

A: The question contains multiple sub-parts and we will answer the first sub-parts.To get the remaining…

Q: Which of the following amino acids is/are ketogenic? A. tyrosine and phenylalanine B.lysine and…

A: A carboxylic acid group, a side-chain distinct to each amino acid, and an amine group are the three…

Q: Identify each of the amino acid in the polypeptide and then name it using the 3-letter…

A: Amino acids are organic compounds having functional group carboxyl and amino. There are 20 amino…

Q: There is parts A-D for the picture provided. A) A peptide has the sequence,…

A: The pKa is the negative value of the logarithm of Ka.  The pKa of the ionizable groups of an amino…

Q: Rank these amino acids from most to least polar. Ço0 HN- C-H H3N- C-H CH2 CH 2 H,N- C-H CH CH 2…

A: The polarity of the amino acids determines the overall structure of a protein in a way. Polar amino…

Q: I-D-E-L-Y-S-Q-V-C-S-H-L-D-T-V-R Circle the hydrophobic residues in the amino acid sequence above…

A: Amino acids are classified into 20 different types based on their physicochemical properties. They…

Q: Amino acids attached together in a straight line structure, is called:

A: Amino acids are chemical compounds that contain the amino and carboxylate functional groups, as well…

Q: A NONAPEPTIDE that attacks and kills cancer cells has just been recently isolated from a rare…

A: The peptides are formed by linking amino acids through peptide bonds between the carboxyl and the…

Q: Rank from left to right the compound with the most reactive chemical linkage: peptide bond, ester,…

A: There are different types of biomolecules found in nature. Various forms of biomolecules include…

Q: 9. Identify the N-terminal and C-terminal amino acid in each peptide. H,N-CH-Ö-Ņ-CH–Ö-o CH2 H CH3…

A: Amino acids are the organic molecule which are linked to form a protein. Each amino acid comprise of…