If a recombination event occurs between the curly hair allele and the straight hair allele, what would be my possible gamete arrangements? Blue eyes Brown eyes Curly hair Straight hair

Q: How does the body restore normal blood calcium levels during a state of hypocalcemia (low blood calc...

A: The body maintains a tight grip on the amount of calcium circulating in the blood at all times. This...

Q: 5. Molecular Evidence. Cytochrome c is a protein located in the mitochondria of cells involved with ...

A: The given circular DNA data indicates that amoeba is closely related to ancestral cell however lizar...

Q: List out Bone loading bearing's material properties (

A: ✓Bone mineral is a ceramic material and exhibits normal Hookean elastic behaviour, i.e. a linear str...

Q: Which biomes are best suited for (a) raisingcrops and (b) grazing livestock? Use the threescientific...

A: A biome is a huge region that is distinguished by its plant, soil, climate, and animals. Aquatic, gr...

Q: You want to breed an apple tree that produced apples with no seeds, yet keeps the specific apples of...

A: Introduction:- An autopolyploid has an additional set of chromosomes that are identical to the paren...

Q: The enzyme trypsin is sold as a dietary supplement.What happens to trypsin taken with food

A: Introduction Enzymes act as catalysts that helps in speeding up a chemical reaction. 

Q: What provides the negative charge associated with DNA? The phosphate groups The nitrogenous bases Th...

A: DNA (Deoxyribonucleic acid) is a molecule that is made up of two polynucleotide chains that coil aro...

Q: 74. Copy Table 2 into your notebook. List three types of steroid molecules, and explain their purpos...

A:    INTRODUCTION      STEROIDS             Steroids are lipids. They are hydrophic and it is insolubl...

Q: How do the eggs ovulated into the abdominal cavity find their way out of the frog’s body?

A: To understand the path of the egg we need to understand that frogs lay eggs. This process usually oc...

Q: State the role of carbon fixation in photosynthesis

A: To define carbon fixation, we must first define fixation. Fixation, in general, refers to the proces...

Q: 1. Is a microscope an absolute necessity for studying microorganisms? Why or why not? 2. What do you...

A: 1:-Naked eyes have limitations to see object, they can't see the object having size less than 100mic...

Q: Deuterostome animal phylogenetic tree

A: A phylogenetic tree, also known as a phylogeny, is a diagram that depicts the lines of evolutionary ...

Q: insect'

A: Insect are small animal with six legs, two pairs of wings and a body which is divided into three par...

Q: What are the two key concepts for this section?Define freshwater. Explain why access to water is ahe...

A: Water is a vital resource that is essential for human survival, health, and economy. Access to clean...

Q: Table 14. Crossing Fl individual with another Fl individual Individual # 213 252 Gender Male Female ...

A: The answer is NO.

Q: What cellular structures of onion are more easily seen in stained as compared to unstained preparati...

A: After staining with potassium iodide, the following structures can be observed by a compound microsc...

Q: 1. What could be the significance of the ability of flowering plants to produce seeds? What advantag...

A: Introduction :- A seed is an ovule that has been fertilised and contains the plant embryo. It will g...

Q: Make simple diagrams tracing the life history of Schistosoma japonicum

A: Schistosoma japonicum:  Schistosoma japonicum is a significant parasite and one of the main schistos...

Q: Carbon Copy (CC), the first cat produced from aclone, was created from an ovarian cell taken from he...

A: Cloning has been around since the late 1800s, but it wasn't until 1997 that Dolly the sheep was succ...

Q: Liverworts were given their name based on this flat, lobed leaf-like structure

A: Liverworts is a flowerless spore producing plant.  English word 'wort ' means "small plant " . The t...

Q: Can someone please explain the distinction of natural selection and evolution of populations?

A: Answer 

Q: In earlobes, free (F) earlobe is dominant while attached (f) earlobe is recessive. What proportion o...

A: Attached and free earlobe condition is controlled by autosomal gene with two alleles. F- responsible...

Q: Explain what occurs during glycolysis, the Krebs (citric acid) cycle, and electron transport chain b...

A: GLYCOLYSIS : * It is an  catabolic metabolic pathway which breakdown glucose into 2 molecules of pyr...

Q: what advantages do regulatory systems provide to the organisms?

A: Introduction :- The neurological system and the endocrine system work in tandem to control and coord...

Q: The expression of antigen A or antigen B in red blood cells requires the help of an H antigen. A rec...

A: Given information Antigen A and antigen B in red blood cells need H antigen for expression. A reces...

Q: . An oligonucleotide (a short DNA or RNA) has the following sequence: ACGTGGTTCCATGGTACGGC (a) Show ...

A: The malting temperature (Tm) of the DNA  is the temperature at which at least 50% of dsDNA is conver...

Q: Identify and explain the way of molecular adaptation of microbes to survive in a high temperature en...

A: A thermophile is an extremophile that survives at temperatures from 40 degree celcius and 122 degree...

Q: Given the following ssDNA, what would be the complementary strand for it to be dsDNA? 5'-GTCAGGTTACG...

A: Both strands of DNA are complementary to each other. Adnan bond with thymine via double bond however...

Q: Please complete the following question: (attached is the question & the table)

A: Nitrogen, Potassium, Calcium, Magnesium, and Phosphorus all are essential elements for the growth an...

Q: 1. Why is necessary to remove fat and tendons from the heart sample? 2. Why is necessary to complete...

A: Since you have asked multiple question, we will solve the first question for you. If you want any sp...

Q: ng potential, the following statements is like not true about the figure/illustration below? * DRY D...

A: Solution : correct option is C

Q: onsider selection on two traits. The selection gradient on trait 1 is -0.2, and the selection gradie...

A: A very different and relatively unknown method for inferring the existence of constraints is to exam...

Q: Use a t chart to distinguish between saturated fats and unsaturated fats.

A: Few important points: We know that lipids are diverse group of organic compounds which are insolubl...

Q: Who was responsible for the X-ray crystallography that determined the shape and structure of DNA? O ...

A: Given: DNA is along polymer of Deoxyribonucleotide. It is made up of two polynucleotide chains that ...

Q: Solutes tend to diffuse from a region where they ar_____ concentrated to an adjacent region where th...

A:

Q: EcoRI 290 bp 3800 bp EcoRI PUC19 PUC19 3400 bp Bgll EcoRI 290 bp EcoRI 1900 bp PUC19 1500 bp

A: A plasmid circular, small, extra chromosomal double stranded DNA (dsDNA). pUC19 plasmid is one the p...

Q: Which of the groups below is capable of only hydrophobic interactions?

A: In general, a molecule with more polar parts less non polar (hydrocarbon) part shows hydrophilic int...

Q: At the metaphase plate during metaphase I of meiosis, there are Select one: A. Chromosomes consistin...

A: Meiosis is a reduction division .it is occured in germ cells of our body.  During metaphase 1 of mei...

Q: What is the benefit of traditional cheese making for Mongolian people today?

A: Mangolias started cheese making in 1300BC Scientist found milk proteins in tooth tartar it suggest t...

Q: 1. Gradualism is the theory that the earth’s features are the result of long-term processes that con...

A: In 1858, Charles Darwin and Alfred Russel Wallace released "the Origin of Species", which detailed D...

Q: Write the modes of action for the following measurements. There may be more than one measurement for...

A: A mode of action (MoA) means a functional or a anatomical change, which results by exposure of a liv...

Q: Chimpanzees, gorillas, and orangutans all have 48 chromosomes, whereas humans have 46. Human chromos...

A: When a part of a chromosome breaks off and gets translocated to another chromosome, leading to genet...

Q: phylogenetic tree?

A: Phylogenetics is a branch of biology that deals with studying and determining the evolutionary relat...

Q: When the pH is acidic, the concentration of H+ is high and functional group(s) [ Select ] will be un...

A: Amino acids is Organic compound they have both acidic and basic functional groups that is why this i...

Q: Explain the difference between a dehydration reaction and hydrolysis reaction.

A: Dehydration and hydrolysis are chemical reactions that are catalysed, or "accelerated," by enzymes. ...

Q: Two distinct species of organisms breed and create a hybrid. The hybrid was the result of nondisjunc...

A: Autodiploidic : condition where cell has two or more copies of single haploid set of a condition in ...

Q: Contrast the role of the repressor in an inducible system and in arepressible system ?

A: The lac operon, or set of genes with a single promoter, is a type of operon (transcribed as a single...

Q: Explain why we say that photosynthesis feeds most life on Earth.

A: Plants absorb CO2 and water (H2O) from the air and soil during photosynthesis. Water is oxidized (lo...

Q: Spongy Bone

A: Red blood cells are formed in the red bone marrow of  the bones . stem cells are called hemocytoblas...

Q: I. Apply your knowledge on the basic structure of amino acids by creating a polypeptide chain that i...

A: The amino acids are the basic structural unit of proteins that contain an alpha carbon which contain...