What cellular structures of onion are more easily seen in stained as compared to unstained preparations? In what part of the cell is your answer?

Q: АCTMTY 10.6.1 Label the diagram and explain the salient feature that is happening in each item. For ...

A: Introduction: Electron Transport Chain is a series of compounds where it makes use of electrons from...

Q: 4. If several pea plants with the genotype TTYY are crossed with pea plants with the genotype Ttyy, ...

A: There will be two heterozygous plant crosses as a result:   T T T TT TT t Tt Tt     Y y...

Q: 1. What could be the significance of the ability of flowering plants to produce seeds? What advantag...

A: Introduction :- A seed is an ovule that has been fertilised and contains the plant embryo. It will g...

Q: Which type of bone has a net-like appearance? Group of answer choices Cortical/Compact Bone No answe...

A: Bones are the structure which help in the formation of the structural unit of the body .

Q: Continuing his experiments, in Miles Morales' genome, the Goblin found similar genes, including one ...

A: In the given case, let the allele associated with invisibility be “I” and allele associated with agi...

Q: . An oligonucleotide (a short DNA or RNA) has the following sequence: ACGTGGTTCCATGGTACGGC (a) Show ...

A: The malting temperature (Tm) of the DNA  is the temperature at which at least 50% of dsDNA is conver...

Q: 1. Why do we pass the smear in the open flame of the bunsen burner 3 times? What do we want to achie...

A: 1.sampling usually have the following stages to identify the bacteria. Staining smear preparation H...

Q: Table 14. Crossing Fl individual with another Fl individual Individual # 213 252 Gender Male Female ...

A: The answer is NO.

Q: A study by the CDC reported that only 73% of children in some areas of the United States are being a...

A: Vaccination is the procedure of injecting a lesser pathogen or a disease's weakened antigen into a h...

Q: Please answer to best of ability asap

A: Introduction Mutation is described as a change in nucleotide sequence or chromosomal structure that ...

Q: You have determined that the gene order for three linked genes being studied is CBA. The number of r...

A: The frequency of recombination events between two genes (i.e., their degree of genetic linkage) is u...

Q: In a population of geese, the narrow-sense heritability for wing span is shown to be 0.5. If the phe...

A: The formula that can be used to calculate narrow-sense heritability is equal to: h2=VAVP Here h2  eq...

Q: Explain The Discovery of CRISPR ?

A: The common technology   that can be used to edit genes is refers as the CRISPR. In other words you c...

Q: Describe the importance of selectively permeable membranes andcompare the functions of carrier prote...

A: The plasma membrane is referred to as a selectively permeable membrane because it allows only partic...

Q: 1. Which is the abiotic factor? A. Bacteria B. Dog 2. Which of the following is a characteristic of ...

A: A dynamic community that contains a set of physical, chemical, and biological variables in a specifi...

Q: Could you give me the answer?

A: 1. Sitting in one place for long hours have many negative effects on our overall health. It results ...

Q: What is the key concept for this section? What isHIPPCO? What is the greatest threat to wild species...

A: Ecology is the study of how living organisms, such as people, interact with their surroundings. Huma...

Q: If a plant that is heterozygous for all theses characters is crossed with a plant homozygous dominan...

A: Mendel choses seven different traits " Pea shape round or wrinkled  Pea color green or yellow  Pod s...

Q: At the metaphase plate during metaphase I of meiosis, there are Select one: A. Chromosomes consistin...

A: Meiosis is a reduction division .it is occured in germ cells of our body.  During metaphase 1 of mei...

Q: How do the eggs ovulated into the abdominal cavity find their way out of the frog’s body?

A: To understand the path of the egg we need to understand that frogs lay eggs. This process usually oc...

Q: Given the highly complex lipid composition of cell membranes, what are the variations within differe...

A: Cells are membrane-bound structure that contains the organelles of the living body. Some of the cell...

Q: Identify features that are present in eukaryotic cells but not in prokaryotic cells. Select all that...

A: Identify features that are present in eukaryotic cells but not in prokaryotic cells. Select all that...

Q: Which of the following is false? a. the pollen grain shape was studied by Mendel. b. Mendel believ...

A: Gregor Mendel is known as the Father of Genetics. He conducted experiments on the garden pea plants....

Q: 1. Enumerate and discuss the illuminating parts of the microscope and give their respective function...

A: A microscope is an optical device that magnifies pictures that are too tiny to see with the naked ey...

Q: 1. Explain how these body system help in maintaining homeostasis.  a.Digestive System- b.Skeletal ...

A: Homeostasis:- Homeostasis refers to the tendency to maintain internal body temperature or is a self-...

Q: What is the process in the plant life cycle that occurs within sporangium and results in spores?

A: There are four stages in the life cycle of a plant: seed, sprout, a little plant a mature plant

Q: The locations of numerous lacI - and lacIS mutations have beendetermined within the DNA sequence of ...

A: c. LacIs is a trans-dominant mutation that stops transcription in both operons. Only the genes cis t...

Q: Unlike most examples of this trait, the height characteristic that Mendel studied in pea plants exhi...

A: Mendel's experiment Mendel studied the seven contrasting characteristics of pea plants. These traits...

Q: 1. Which of the following drugs is not a cardioselective beta-blocker? * A. Esmolol B. Atenolol C. P...

A: Since you have asked multiple question, we will solve the first question for you. If you want any sp...

Q: Can someone please explain the distinction of natural selection and evolution of populations?

A: Answer 

Q: In mice, brown fur color is dominant to black fur color. Another gene affects the production of pigm...

A: Epistasis occurs when the expression of one gene is influenced by the activation of one or more gene...

Q: The frequency of single crossover recombinant gametes (those with chromosomes having crossed over) o...

A: Crossing over takes place in prophase I of meiosis that results in exchange of genetic material betw...

Q: 1. To create a fully functional protein, how do their structure help in determining its function? 2...

A: 1. A fully functional protein is generally found in tertiary or quaternary structure. The tertiary p...

Q: What is the number and types of lamprey species that are present in the Great lakes?

A: ANSWER;- 1. 5 number present in the Great lakes. Many people believe the obtrusive ocean lamprey is ...

Q: How long does it take to transcribe gene

A: Transcription is the process by which RNA Polymerase read out the DNA and synthesized RNA. RNA polym...

Q: Solutes tend to diffuse from a region where they ar_____ concentrated to an adjacent region where th...

A:

Q: The following experiment was set up to understand how catechol oxidase converts catechol oxidase cat...

A: Catechol  Pyrocatechol or 1,2-dihydroxybenzene are other names for it. It is the ortho isomer of the...

Q: Explain why living things need to reproduce and discuss the types of reproduction

A: Reproduction is the process by which an independent individual is brought into existence by a preexi...

Q: Thomas Malthus argued that human populations grow faster than the resources they depend on true or ...

A: Evolution is the gradual process, Biodiversity is the result of evolution. Evidence for evolution ca...

Q: If a species looks superficially the same after thousands of years, the most likely explanation is: ...

A: Introduction:- Convergent Evolution occurs when thousands of years pass and a species appears to be ...

Q: What objects are shown with labels : F (back of the throat), A the FLAP between esophagus and larynx...

A: Introduction: The image depicts here the respiratory system of humans that starts with the nasal cha...

Q: In what direction is there a net movement of particles along their concentration gradient? Would you...

A: Diffusion is the movement of substances in a passive way.  

Q: i need help finding the right answers

A: The nucleotide polymers that are responsible for determining and the regulating the genetic characte...

Q: Describe three methods of bacterial count and their advantages

A: A substance's total bacteria count (TBC) is a numerical estimate of the number of microorganisms pre...

Q: You are studying a transport protein. It appears to bind temporarily to the molecule to be transport...

A: 1. ANSWER;- This is an example of facilitated diffusion. The molecule is a competitive inhibitor. -I...

Q: To avoid or lessen sunburn while in the aquatic facility, generously apply sunscreen. Reapply every ...

A: The first statement is correct as the generous application of sunscreen avoids and lessens sunburn. ...

Q: What happens if the body's cellular respiration system malfunctions? Explain your answer

A: Malfunction is defined as something stops working. Cellular respiration is process which occurs to b...

Q: Can you help me identify the specific structure pointed

A: This is transverse section of kidney. The labelled pointed section attached below.