If the DNA of chromosome 1 is fully extended, it will exceed the diameter of the nucleus of a cell by about 15,000 times. Therefore, discuss how DNA is packaged into the cell.

Q: A circular molecule of DNA contains 1 million base pairs. If the rate of DNA synthesis at a…

A: in prokaryotes, the genomic DNA is in a circular format and adopt the theta replication model,…

Q: How many adenine bases are there if there are eight thousand cytosine bases in a fifteen thousand bp…

A: Question - How many adenine bases are there if there are eight thousand cytosine bases in a fifteen…

Q: Why Heterochromatin spreads linearly?

A: Heterochromatin refers to the part of the chromosomal regions that appear dark due to the…

Q: Which of the following statements are correct? explain your answers.A. each eukaryotic chromosome…

A: DNA is the double-stranded molecule that is the genetic material in most animals except for some…

Q: Each cell of the human body contains 46 chromosomes. How many DNA molecules does this statement…

A: Chromosomes are thread-like molecules that carry hereditary information for everything from height…

Q: Assume that a certain bacterial chromosome has one origin of replication. Under some conditions of…

A: The replication in bacteria will be bidirectional hence initially two replication fork per Double…

Q: We seem to know more about the structure of eukaryotic chromosomal DNA than bacterial DNA. Discuss…

A: Deoxy ribonucleic acid (DNA) is the genetic material of most organisms that carry coded genetic…

Q: A part of a sequenced chromosome has the sequence (on one…

A: DNA is the genetic element in all cell types of prokaryotic and eukaryotic. DNA is double stranded…

Q: If a human nucleus is 10 mm in diameter, and it must hold as much as 2 m of DNA, which is complexed…

A: A cell is a structural and functional unit of life. The structure and function of a cell have been…

Q: Most prokaryotes have a circular chromosome, with no ends, so the shortening of DNA does not occur.…

A: To forestall the loss of genes as chromosome closes wear out, the tips of eukaryotic chromosomes…

Q: You have been sent the first samples of a newly discovered Martian microorganism for analysis of its…

A: Packaging of Eukaryotic DNA is highly ordered. Initially the DNA(negatively charged) is conjugated…

Q: In light of your knowledge of DNA replication, discuss the following statement: "Only the DNA is…

A: Dna replicates semiconservatively is proven by matthew meselson and franklin stahl by performing an…

Q: If a human nucleus is 10 mm in diameter, and it must hold as much as 2 m of DNA, which is complexed…

A: The nucleus is the main membrane-bound cell organelle present in the eukaryotic cell, its structure…

Q: Let’s suppose you have isolated chromatin from some bizarre eukaryote that has a DNA linker region…

A: The DNA (deoxyribonucleic acid) of non-dividing and interphase cells exists in the form of…

Q: For a linear B-DNA molecule of 50,000 kb, calculate (a) the contour length and (b) the length of the…

A: The complexity of an organism is based on the functioning of its genome. Deoxyribonucleic acid (DNA)…

Q: define nuclear DNA

A: The term DNA stands for deoxyribonucleic acid. Deoxyribonucleic acid is the most important…

Q: The telomeres of a linear chromosome are made of identical directly repeated DNA sequences. How does…

A: Telomeres:These are the special DNA caps in the eukaryotic chromosomes that prevent the loss of…

Q: Although human DNA has a total length of 2 m, it is packaged into a nucleus that is 5 µm in…

A: Cells wrap their DNA strands around scaffolding proteins to form chromatin, a coiled compact…

Q: Distinguish between heterochromatin and euchromatin.

A: Two types of chromatin (euchromatin and heterochromatin) are distinguishable during the interphase.…

Q: With regard to DNA replication, define the term bidirectional replication.

A: Deoxyribonucleic acid (DNA) is a double-stranded molecule, which consists of two strands of…

Q: In a DNA double helix, why doesn't an A or T form two hydrogen bonds (out of the three possible )…

A: The DNA (deoxyribonucleic acid) is composed of nucleotides that are in turn made up of nitrogenous…

Q: If the DNA of one human cell is stretched out, it would be almost 6 feet long and contain over three…

A: DNA  DNA is the hereditary unit of an organism which transfer from parents to their offsprings. It…

Q: Of adding lable sait Table salt dissociates into Na* and Cl" in water. The Na* binds to positively…

A: DNA extraction is the chemical method that is used to isolate or extract DNA from the nucleus and…

Q: The sequence below shows the ends of one strand of a linear chromosome, with slashes representing…

A: DNA is the nucleic acids present in the organisms. DNA is the deoxy-ribose nucleic acid in which…

Q: If a double stranded DNA has 20 per cent of cytosine, calculate the percent of adenine in the DNA.

A: Deoxy ribonucleic acid (DNA) is the genetic material of most organisms that carry coded genetic…

Q: If a double stranded DNA HAS 20 PERCENT OF CYTOSINE, calculate the percent of adenine of adenine in…

A: According to Chargaff's rule, A = T and G = C, as adenine (A) binds with thymine (T) and guanine (G)…

Q: 5.1) Do you expect DNA strands 1 and 2 below to have the same melting point? Justify your answer.…

A: As per bartleby guidelines we are only allowed to answer one question. Please post the other…

Q: Describe the structure of DNA. The two strands of DNA are antiparallel. What does the term…

A: DNA contains all organism's order for growth, survival, and reproduction. DNA sequences must be…

Q: Some portions of the chromosomes are coiled with inactive genes as electron- dense masses of…

A: DNA(deoxyribonucleic acid) is a molecule comprised of two polypeptide chains that coil around each…

Q: 3' - AACCAGTGGTATGGTGCGATGATCGATTCGAGGCTAAAATACGGATTCGTACGTAGGCACT - 5'    Q:  Based on written…

A: The DNA has two strands one is the Template strand and other is the coding strand. Based on the…

Q: When chromatin is treated with non-specific nucleases, what is the length of the resulting pieces of…

A: Nucleases are the enzymes that digest the nucleic acids.

Q: What is the difference between euchromatin and heterochromatin?

A: Chromatin is a complex of deoxyribonucleic acid (DNA) and protein present in eukaryotic cells. The…

Q: The structure that gives terminal : stability of chromosomes is

A: A chromosome is a thread-like structure that is composed of DNA. They are found in the nucleus of…

Q: Histone _______ is not part of the histone octamer, but binds to linker DNA and is responsible for…

A: Histones are a family of basic proteins that associate with DNA in the nucleus and help condense it…

Q: Some portions of the chromosomes are coiled with inactive genes as electron-dense masses of…

A: Packaging of DNA: The DNA in eukaryotes is assembled into chromatin, which are complexes made of…

Q: Put the following levels of chromosome organization in order from least complex (least packaged…

A: The word chromosome arises from the Greek word chroma means color and soma which means body because…

Q: Forming nucleosomes and wrapping them into a 30-nm fiber provide part of the compaction of DNA in…

A: Introduction: DNA is a type of nucleic acid that is present in the nucleus of the cell. It is the…

Q: Replication is a process that ensures that genetic information is conserved and transmitted among…

A: DNA replication is the process by which DNA makes a copy of itself during cell division.

Q: What type of chromosomal rearrangement occurs If a single chromosome suffers two double-strand…

A: To explain: To explain type of chromosomal rearrangement in the double stranded breaks in single…

Q: In the following diagram of DNA replication fork, A is a subunit of DNA polymerase Ill. O b. y…

A: DNA polymerase III is used in the synthesis of Chromosomal DNA. DNA pol III participates in the DNA…

Q: In eukaryotes, the Replication factor C (RFC) is a clamp loader. In the absence of RFC, what would…

A: The Replication factor C (RFC) is the accessory proteins that's is essential for the processive DNA…

Q: Starting with one molecule of double stranded DNA, how many cycles of denaturation and annealing…

A: Breakdown of H- bond and peptide bond in DNA is said to br denaturation Attaching if primer to the…

Q: The average human chromosome contains about 1 x 108 bp of DNA. (a) If each base pair has a mass of…

A: Compaction ratio is the ratio of extended length to actual length. Length of total DNA is the…

Q: Electric Forces in Biology• Describe how a water molecule is polar.• Explain electrostatic screening…

A: Since we only answer 1 question in case of multiple questions, we’ll answer the first question as…

Q: Letter 'b' corresponds to 3' 5' 5 3' 5' 3' 3' 5' O leading strand. lagging strand. daughter strands.…

A: DNA replication is a crucial step as name suggests replica of a DNA (two replicas) is formed by…

Q: The average human chromosome contains about 1 x 108 bp of DNA.(a) If each base pair has a mass of…

A: A chromosome is a long DNA molecule with part or all of the genetic material of an organism.

Q: A B-DNA molecule has 1 million nucleotide pairs. How many complete turns of the helix are there in…

A: Majority of DNA present in the cytoplasm of living cells exist in double helical structure as…

Q: The two strands of a DNA double helix can be separated by heating. if you raised the temperature of…

A: In the DNA strands, between every A-T base-pairing there are two hydrogen bonds present while In…

Q: What size DNA fragment would be released after very mild digestion of chromatin with micrococcal…

A: Introduction  Micrococcal nuclease in as example of endo-exonuclease which is obtained from…

Q: Name 3 structural features of the DNA and how they help the DNA perform its functions

A: DNA is made up of four nitrogenous encode bases adenine ,guanine ,cytosine and thymine.  These four…

Viral Replication

The virus is acellular and considered non-living outside the host cell. The replication of the virus occurs only inside the living cells. Only a few genes are present in the smallest virus, whereas many genes are present in the largest virus. These genes encode specific viral proteins.