18.6 Electric Forces in Biology Classical electrostatics has an important role to play in modern molecular biology. Large molecules such as proteins, nucleic acids, and so on-so important to lifeare usually electrically charged. DNA itself is highly charged; it is the electrostatic force that not only holds the molecule together but gives the molecule structure and strength. Figure 18.28 is a schematic of the DNA double helix. This OpenStax book is available for free at http://cnx.org/content/col11406/1.9 Chapter 18 | Electric Charge and Electric Field 711 Figure 18.28 DNA is a highly charged molecule. The DNA double helix shows the two coiled strands each containing a row of nitrogenous bases, which "code" the genetic information needed by a living organism. The strands are connected by bonds between pairs of bases. While pairing combinations between certain bases are fixed (C-G and A-T), the sequence of nucleotides in the strand varies. (credit Jerome Walker)

18.6 Electric Forces in Biology Classical electrostatics has an important role to play in modern molecular biology. Large molecules such as proteins, nucleic acids, and so on-so important to lifeare usually electrically charged. DNA itself is highly charged; it is the electrostatic force that not only holds the molecule together but gives the molecule structure and strength. Figure 18.28 is a schematic of the DNA double helix. This OpenStax book is available for free at http://cnx.org/content/col11406/1.9 Chapter 18 | Electric Charge and Electric Field 711 Figure 18.28 DNA is a highly charged molecule. The DNA double helix shows the two coiled strands each containing a row of nitrogenous bases, which "code" the genetic information needed by a living organism. The strands are connected by bonds between pairs of bases. While pairing combinations between certain bases are fixed (C-G and A-T), the sequence of nucleotides in the strand varies. (credit Jerome Walker)

Human Heredity: Principles and Issues (MindTap Course List)

11th Edition

ISBN:9781305251052

Author:Michael Cummings

Publisher:Michael Cummings

Chapter8: The Structure, Replication, And Chromosomal Organization Of Dna

Section: Chapter Questions

Problem 12QP: DNA contains many hydrogen bonds. Are hydrogen bonds stronger or weaker than covalent bonds? What...

See similar textbooks

Similar questions

DNA contains many hydrogen bonds. Are hydrogen bonds stronger or weaker than covalent bonds? What are the consequences of this difference in strength?
The length of a DNA molecule is 680 nm when the DNA molecule is in B-conformation. How many helical turns does the DNA molecule have if the DNA molecule is in A-conformation?
22-71 Indicate whether each of the following statementsinvolving differences between DNA and RNA moleculesis true or false.a. Base pairing occurs in DNA but not in RNA.b. Both DNA and RNA are double-stranded molecules.c. RNA molecules are much larger than DNAmolecules.d. The base T in DNA is replaced by the base A in RNA
DNA Structure A. Draw an A-T base pair with the appropriate number of hydrogen bonds. You don’t have to include all the details such as every side-group but do depict the 3’ OH groups. B. What is meant by anti-parallel when referring to a DNA molecule? C. What are the major and minor grooves in the DNA structure and what significance do they have?
A double-stranded DNA molecule contains 560 nucleotides. Howmany complete turns occur in this double helix?
5' UGUCAUGCUCGUCUUGAAUCUUGU GAUCCUCGUUGGAUUAAUUGU— 3' Translate the sequence of bases in the previous question, starting at the second base.
Draw the structure of deoxyribose and number the carbon atoms.Describe the numbering of the carbon atoms in deoxyribose withregard to the directionality of a DNA strand. In a DNA doublehelix, what does the term antiparallel mean?
Z-DNA derives its name from the zig-zag conformation ofphosphate groups. What features of the DNA molecule allowthis distinctive structure to form?
In a DNA Double helix ,why doesn't an A or T form two hydrogen bonds(out of the three possible) with G or C? Explain in detail.
The complementary strands of DNA in the double helixare held together by hydrogen bonds: G ≡ C or A = T.These bonds can be broken (denatured) in aqueous solutions by heating to yield two single strands of DNA(see Figure 1-13a). How would you expect the relativeamounts of GC versus AT base pairs in a DNA doublehelix to affect the amount of heat required to denatureit? How would you expect the length of a DNA doublehelix in base pairs to affect the amount of heat requiredto denature it?
In a DNA double helix, why doesn't an A or T form two hydrogen bonds (out of three possible) with G or C?
Each nucleotide pair of a DNA double helix weighs about 1 × 10 −21 g. The human body contains approximately 0.5 g of DNA. How many nucleotide pairs of DNA are in the human body? If you assume that all the DNA in human cells is in the B-DNA form, how far would the DNA reach if stretched end to end?