If the following is a restriction enzyme: Sma I, A. What is the first letter represent? B. What do the next two letters represent? C. What does the roman numeral represent?

Q: Which of the following sequences is most likely to be recognized and cut by a 6- cutter restriction…

A: Restriction enzyme is an enzyme that cuts DNA into small fragments at specific sites within…

Q: A piece of linear DNA is 700000 base pairs in length and is digested with a restriction enzyme that…

A: Linear DNA is found in prokaryotes, which is linear in shape with two free ends. Restriction enzymes…

Q: Write any two properties of restriction endonuclease enzymes?

A: Enzymes that can cleave the DNA at specific sites are known as restriction enzymes. There are two…

Q: Using nucleotide letters, show the kind of cut that could be made on a DNA molecule to circularize…

A: A plasmid is a small, extrachromosomal DNA molecule within a cell that is different from the…

Q: What is a restriction enzyme? What structure does it recognize?What type of chemical bond does it…

A: Werner Arber, a Swiss microbiologist, winner of 1978 Nobel Prize in Physiology, for his discovery…

Q: When a 5-kb circular plasmid is digested with a restriction enzyme that has three recognition sites…

A: The restriction enzymes are present in bacteria and in other prokaryotes. The restriction enzymes…

Q: The following diagram shows one-half of a restriction site. (a) Draw the other half. GAC G I C (b)…

A: Introduction: The genetic material in the living organism that transfer from one generation to…

Q: You have a DNA sequence of 1800 bp. To characterize it, you decide to make a restriction map.…

A: Restriction mapping is a process that helps to determine the location of the restriction site. The…

Q: What is the job of the restriction enzyme?

A: In the year 1963 the two enzymes responsible for restricting the growth of bacteriophage in E. coli…

Q: A new restriction enzyme is discovered. It recognizes a 6 base pair pallindromic sequence. The first…

A: BASIC INFORMATION  RESTRICTION ENZYME  they are also known as molecular scissors it was in the year…

Q: Which of the restriction enzymes listed in the table below produces blunt-end fragments? Enzyme…

A: The blunt end are produced by the restriction enzymes when the end of a DNA fragment  after breaking…

Q: Which of the following sequences, when combined with itscomplement, would be clipped by a…

A: Restriction endonuclease is also known as restriction enzymes that are produced by the bacteria.…

Q: Features of restriction enzymes include the following, except  __________ . a. They are produced…

A: Restriction enzyme is a group of enzymes which involves the cleaving of DNA molecule at a specific…

Q: Draw a diagram showing what pGEM will look like after it has been digested with BamHI.

A: BamHI: BamHI is a restriction enzyme obtained from Bacillus amyloliquefaciens that specifically cuts…

Q: What is a restriction enzyme? How can restriction enzymes be used to splice a piece of human DNA…

A: BASIC INFORMATION ENZYMES They are the catalyst. They help in accelerating the chemical reaction.…

Q: You are studying a protein that contains the peptide sequence RDGSWKLVI. The part of the DNA…

A: The restriction endonuclease are responsible for cutting the DNA at specific sequence and they…

Q: Which two restriction enzymes where used to completely digest the DNA fragment above based on the…

A: Restriction endonucleases are the enzymes which cleave the DNA at specific sites from within and…

Q: a restriction enzyme is one that?

A: A restriction enzyme is a most important tool in recombinant technology. The alteration of the…

Q: What normal role do restriction enzymes play in bacteria? How do bacteria protect their own DNA from…

A: A restriction enzyme is a protein that recognizes a particular DNA sequence and cuts the DNA at a…

Q: What are restriction enzymes?

A: Restriction enzymes are found in bacteria, their function is to recognise and cut a specific site on…

Q: Consider a partial restriction digestion, in which genomic DNA is exposed to a small, limiting…

A: The process of cutting or cleaving DNA by using restriction enzymes is called digestion or…

Q: A) For this DNA fragment "TGAATTCCCGGGTTCCGGGAATTCGCGCGAATT CCCGGTATA", what is its complementary…

A: DNA (deoxyribonucleic acid) is a double-stranded nucleotide sequence that is intertwined and…

Q: Which of the following is most likely to be a restriction enzyme recognition sequence? O AAAAAA O…

A: A palindromic sequence is a sequence of nucleic acids within double helix of DNA and / or RNA that…

Q: You want to insert a sequence in the lacI gene to alter its function,what restriction enzyme(s) will…

A: The lacI gene is a part of the lac operon, that codes for a protein that inhibits the expression of…

Q: What does it mean if a restriction enzyme produces ‘sticky’ or ‘blunt’ ends? Does the restriction…

A: The sticky or blunt ends refers to the edges of DNA molecules. The sticky ends tend to overlap to…

Q: How to determine the location of restriction sites for different enzyme ?

A: Enzymes are proteins that are present in the body and help to speed up metabolism or other chemical…

Q: What is the function of a restriction enzyme?

A: Restriction enzymes are enzymes that are isolated from bacteria that can cleave single-stranded or…

Q: Dr. Doom has a DNA sequence of 2000 bp. Enzyme X and Enzyme Y restriction sites and their positions…

A: Restriction enzymes are the enzymes which cut DNA at particular site.

Q: Restriction maps illustrate the lengths of DNA fragments between restriction sites. Which of the…

A: Restriction mapping is a technique to map unknown segment of DNA by breakung it into small…

Q: Which of the DNA sequences shown below can be cut by using restriction enzyme' Explain your answer…

A:

Q: Explain the Restriction Enzymes ?

A: An enzyme derived from microbes that breaks DNA molecules at specified sequences is known as a…

Q: Using what you now know about restriction enzymes, why do you suppose that wells in the gel…

A: DNA (deoxyribonucleic acid) is the genetic material in most organisms. Recombinant DNA (rDNA)…

Q: The gene you are asked to clone is 30,000 bps in length. When you are choosing a suitable…

A: Introduction  Enzymes are the crucial biomolecules which assists in various biochemical reactions…

Q: What is a restriction digest? What does it mean if you were given a precut DNA?

A: Restriction enzyme digestion takes advantage of naturally occurring enzymes that cleave DNA at…

Q: If a restriction enzyme cuts at this DNA sequence: TACGGAT, in general what is this sequence called?

A: DNA is a double-stranded molecule consisting of two strands of nucleotides. The bases in one strand…

Q: How do Restriction Enzymes like EcoRI work?

A: Restriction endonucleases  are the enzymes which is used to cut particular region of DNA . They make…

Q: Which of the following sequences in double-stranded DNA ismost likely to be recognized as a cutting…

A: Enzymes that can cleave the DNA at specific sites are known as restriction enzymes. There are two…

Q: Assume that a circular plasmid is 3200 base pairs in length and has restriction sites for HindIII…

A: Restriction endonucleases are the enzymes which recognize and cleaves DNA to make smaller fragments.…

Q: sequence? Which enzyme will cut this sequence and where in the sequence? What is the sequence of the…

A: Given: Need to find the recognition sequence and sequence of the 'sticky end' produced by this…

Q: Which of the following sequences, in the double-stranded form, can probably be recognized by a…

A: Restriction enzymes are those enzymes that specifically bind to specific DNA sequences and these…

Q: Which of the following sequences in double-stranded DNA is most likely to be recognized as a cutting…

A: Restriction enzymes are also known as molecular scissors because they cut the DNA at specific, short…

Q: are restriction endonuclease enzymes named? Write examples.

A: Restriction enzymes break DNA at or near certain recognition sequences known as restriction sites,…

Q: Restriction enzymes are essential tools in genetic engineering. Discuss with diagrams

A: As per our guidelines, we are supposed to answer only one question. Kindly repost the other question…

Q: Which of the following is true about restriction endonucleases?a) Type I and II requires ATP to move…

A: Restriction endonucleases are the specific DNA sequences that cleaves the sugar-phosphate backbone…

Q: What are palindromes, and how are they related to restriction endonucleases? Why are they useful for…

A: The two strands of polynucleotides that make up the DNA molecule are intertwined in a helical…

Q: The most usefulplasmids contain a _______, which is a short, syntheticDNA sequence that contains a…

A: Plasmid fingerprinting is performed in many organisms like Escherichia coli, Salmonella,…

Gene Interactions

When the expression of a single trait is influenced by two or more different non-allelic genes, it is termed as genetic interaction. According to Mendel's law of inheritance, each gene functions in its own way and does not depend on the function of another gene, i.e., a single gene controls each of seven characteristics considered, but the complex contribution of many different genes determine many traits of an organism.

Gene Expression

Gene expression is a process by which the instructions present in deoxyribonucleic acid (DNA) are converted into useful molecules such as proteins, and functional messenger ribonucleic (mRNA) molecules in the case of non-protein-coding genes.