If you were to compare the amino acid sequences of histone proteins across several distantly-related species (say, plants, animals, fungi), would you expect the sequences to be highly similar or highly varied? Explain your reasoning.

If you were to compare the amino acid sequences of histone proteins across several distantly-related species (say, plants, animals, fungi), would you expect the sequences to be highly similar or highly varied? Explain your reasoning.

Biology: The Dynamic Science (MindTap Course List)

4th Edition

ISBN:9781305389892

Author:Peter J. Russell, Paul E. Hertz, Beverly McMillan

Publisher:Peter J. Russell, Paul E. Hertz, Beverly McMillan

Chapter19: Genomes And Proteomes

Section: Chapter Questions

Problem 1ITD: Below is a sequence of 540 bases from a genome. What information would you use to find the...

See similar textbooks

Related questions

Q: It is conceivable for codons encoding a single amino acid to share the first two bases while…

A: Protein synthesis occurs in all organisms in two main steps: transcription and translation. DNA…

Q: How many copies of each type of core histone would it take to wrap the entire human genome into…

A: Introduction -The haploid human genome is made up of roughly 3 billion base pairs of DNA organised…

Q: What is meant by “Universality and Degeneracy” of the Genetic Code? What is the significance of the…

A: DNA have four bases, A, T, G and C, and proteins are made up of 20 different amino acids. Thereby…

Q: Suppose you performed two BLAST searches, one on the peptide sequence FIDPWE, and another on the…

A: BLAST is a computer algorithm that is available for use online at the National Center for…

Q: The b1 allele encodes a transcription factor that stimulates production of anthocyanin, a purple…

A: It is given that seven tandem repeats were deleted that are located 100,000 bp upstream of the b1…

Q: The A+T:G+C ratios in DNA of cattle and rat are very similar. Would you expect the +RNAs, rRNAs,…

A: Gene expression refers to the highly regulated complex biological mechanism involving the…

Q: Which of the sequences below do you think would most likely be found in an intrinsically disordered…

A: Intrinsically disordered proteins (IDPs) are those that do not have a proper three-dimensional…

Q: A scientist wants to use a technique that allows to shuffle protein domains. Protein A and Protein B…

A: Ans: Protein domain: The protein carries separate region in the polypeptide protein which shows…

Q: In a typical eukaryotic cell, would you expect to find more molecules of the H1 histone or more…

A: Histones are basic proteins that are associated with the DNA present in the nucleus and help in…

Q: In an ongoing research of the Philippine Genome Centre, using a repeating copolymers, ACA....…

A: A copolymer is a polymer made up of two or more species of monomer. Periodic copolymers are made up…

Q: Why did geneticists believe, even before direct experimental evidence was obtained, that the genetic…

A: Genetics is the study of how traits are passed from one generation to another. This includes but is…

Q: The A+T: G+C ratios in DNA of cattle and rat are very similar. Would you expect the tRNA, rRnas, and…

A: Chargaff's rules state that DNA from any species of any organism should have a 1:1 protein…

Q: Approximately what portion of the human genome is composed of repeat sequences?

A: According to the results found in the human genome studies it is seen that the human genome has…

Q: . The physicist Stephen Hawking, famous for his theories about black holes, has lived past the age…

A: Amyotrophic lateral sclerosis (ALS) is a paralyzing neurodegenerative disease which is usually fatal…

Q: Consider a single base insertion mutation between the 3rd and 4th codons in a natural gene that…

A: Amino acid The building blocks of proteins. The protein is a polymer made up of chain of amino…

Q: Would a gain of function mutaion that occurs in the first exon of a gene with twelve exons more…

A: Gain-of-function type of mutation is a mutation in which the altered gene product possesses a new…

Q: Explain why it is sometimes difficult to locate genomic regions that encode a protein.

A: A gene is a DNA-based functional heredity unit that delivers instructions for the production of RNA…

Q: A geneticist discovers that two different proteins are encoded by the same gene. One protein has 56…

A: A gene is a stretch of nucleotides present in the DNA molecule. It encodes information for the…

Q: The human genome has approximately 30,000 genes, but human cells can produce over 100,000 different…

A: The human genome consists of complete set of sequences of nucleic acid which are encoded as DNA.…

Q: Although techniques are available for determining the sequences of amino acids in proteins, it is…

A: It is easier to sequence proteins indirectly by determining the base sequence of the gene for…

Q: One of the following is a characteristic of eukaryotic genetic material? 1. Eukaryotic genetic…

A: DNA is the hereditary genetic material found in cells of living organisms. In eukaryotic cells, DNA…

Q: The A+T: G+C ratios in the DNA of cattle and rats are very similar. Would you expect the tRNAs,…

A: Ribonucleic acid (RNA) is a vital biological macromolecule found in all living organisms. It is…

Q: There are characteristic differences in the nucleotide sequences of the leading and lagging strands.…

A: Deoxyribonucleic acid(DNA) is a molecule that contains two polynucleotide chains that coil around…

Q: The genomes of most multicellular eukaryotes encode~25,000 genes, yet their proteomes contain over…

A: Genes are the stretch of the DNA that codes for the polypeptide chain during the process of gene…

Q: To create a DNA:RNA hybrid from a short stretch of DNA with the sequence 5'-GGCTAAGTATGCCTAGTAGC-3',…

A: DNA: RNA hybrid are the structures that are formed between the newly synthesized RNA and the dsDNA.…

Q: The DNA-binding domain of each CREB protein subunit recognizes the sequence 5′–TGACGTCA–3′. Due to…

A: Transcription is the molecular process of synthesis of RNA from DNA. The genetic code of DNA is…

Q: The average of a number of closely related but nonidentical sequences is referred to as a(n)…

A: Homologous sequence

Q: By base-pair substitution, what are all the synonymouschanges that can be made starting with the…

A: The example of CGG is RNA codon which transiently binds with the transfer RNA by simple base pairing…

Q: Would you be more likely to find single nucleotidepolymorphisms (SNPs) in the protein-coding or in…

A: Single nucleotide polymorphisms in short SNPs refer to the variation in a single base pair that…

Q: An ORF 1,200 bp in length can encode a protein of what size?

A: Proteins Proteins are the building block of our body they are synthesized by the process of…

Q: Why is rRNA so suitable for determining relatedness?

A: Cells form life's basic unit. A cell has different macromolecules, including carbohydrates,…

Q: Are the following base sequences sticky or not sticky? Each piece is written 5′ to 3′.(a) TTAGC and…

A: A base is nitrogen containing heterocyclic compound which, is found in DNA and RNA. There are…

Q: Suppose that a nearly perfect 20- basepair inverted repeat is observed in a DNA sequence. Provide…

A: The copies of the DNA sequences that are organized in opposing orientation are called “inverted…

Q: If proteins were composed of only 12 different kinds of aminoacids, what would be the smallest…

A: A codon is a sequence of 3 DNA/RNA nucleotides that corresponds to a specific amino acid during…

Q: An alanine residue exists at position 180 of a certain plant protein. If the codon specifying…

A: Substitution Replacement of one Nitrogenous base by another Nitrogenous base is called as…

Q: Explain how a multiple sequence alignment can identify functional sites in a genetic sequence.

A: Sequence alignment can be defined as the pattern of arranging the sequences of DNA, RNA, or protein…

Q: In many eukaryotic organisms, a significant proportion of cytosine bases are naturally methylated to…

A: Cytosine methylation is a type of post-replication DNA modification seen in both prokaryotes and…

Q: Explain why polypeptides have such variable sequences.

A: Polypeptides are the polymers of the amino acids which are linked to each other by a peptide bond.…

Q: A hypothetical base sequence of an RNA molecule is5′–AUUUGCCCUAGCAAACGUAGCAAACG–3′What topic in…

A: Answer: Introduction: RNA molecule consists of four nucleotide bases these are adenine (A), cytosine…

Q: What are the key properties of the genetic code? Given that the genomes of all organisms are made up…

A: Genetic code is the sequence of nucleotides in DNA or RNA which determines the sequence of amino…

Q: Why does the sequence ITLIIFGVIAGVIGTILLI more likely to contain a membrane-spanning sequence?

A: The proteins or peptides that are inserted into the plasma membrane are called integral membrane…

Question

Definition Definition Diverse group of organisms that primarily obtain nutrients through absorption. They range from single-celled yeasts to complex multi-cellular structures such as mushrooms. Fungi play important roles in ecosystems as decomposers, plant symbionts, and even pathogens. They also have practical uses in medicine, food production, and industry.

Expert Solution

This question has been solved!

Explore an expertly crafted, step-by-step solution for a thorough understanding of key concepts.

This is a popular solution!

SEE SOLUTION Check out a sample Q&A here

Step 1

VIEW

Step 2

VIEW

Trending now

This is a popular solution!

Step by step

Solved in 2 steps

SEE SOLUTION Check out a sample Q&A here

Knowledge Booster

Learn more about

Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.

Similar questions

If you know the sequence of amino acids in a protein, what does the genetic code table allow you to infer about the sequence of base pairs in the gene that specifies that protein?
The human genome contains thousands of sequences known as small open reading frames, some of which encode proteins of about 30 amino acids. What is the minimum number of nucleotides required to encode such a protein?
What portions of the above genomic sequence actually code for amino acids?
The A+T: G+C ratios in DNA of cattle and rat are very similar. Would you expect the tRNA, rRnas, and mRNAs of the two species to be similar?
If a bacterial protein is 3,300 amino acids long, how many nucleotidepairs long is the gene sequence that codes for it?
Which of the following (A through E ) would you expect to find in a nucleotide chain constructed for Sanger sequencing?
What is meant by the statement “The genetic code is universal”? What is the significance of this finding?
Suppose you are a research assistant in a lab studying dna-binding proteins. you have been given the amino acid sequences of all the proteins encoded by the genome of a certain species and have been asked to find candidate proteins that could bind dna. what type of amino acids would you expect to see in the dna-binding regions of such proteins?
Consider a single base insertion mutation between the 3rd and 4th codons in a natural gene that encodes a protein 100 amino acids long. Is it more likely that the protein produced by this mutant allele will be shorter or longer than 100 amino acids long?
What are the key properties of the genetic code? Given that the genomes of all organisms are made up of As, Ts, Cs, and Gs, how does one account for diversity in organisms? What are some factors that could adversely affect diversity in nature?
How many binary sequences of length n contain at most five 1 digits? The genetic code specifies an amino acid through a sequence of three nucleotides. Each nucleotide can be of one of the four types T, A, C and G, beingrepetitions allowed. How many amino acids can be encoded in this way?And if there are n types. Compare
Although techniques are available for determining the sequences of amino acids in proteins, it is becoming more and more common to sequence proteins indirectly by determining the base sequence of the gene for the protein and then inferring the amino acid sequence from the genetic-code relationships. Suggest why the latter technique is being used for proteins.