Which of the sequences below do you think would most likely be found in an intrinsically disordered protein? GSSKSSKKREPS MVLITTEVKAT MVLITTEVIIAA
Q: What causes platelets to adhere to the wall of a broken vessel? exposure of collagen fibers histam...
A: Hemostasis is the process through which the body prevents wounded blood vessels from bleeding. Too l...
Q: Patient is a 60-year old female with fasting (has not eaten for at least 8 hours) blood glucose leve...
A: Normal fasting blood glucose concentrations should be between 80 mg/dL (3.9 mmol/L) and 100 mg/dL (5...
Q: Norm Scully has led a life of gluttonous excess for the past 40 years. Because of this, he wants to ...
A: Let us look into the meaning of each type of research - 1. Technical analysis - In this context, te...
Q: Please choose all the correct statements regarding early chordates. Amphioxus has all four defining ...
A: Amphioxus has all four defining chordate characteristics as an adult- This statement is Correct beca...
Q: embryos are exposed to this drug during an early stage of organogenesis, they develop severe skeleta...
A: Hox genes are involved in embryonic development as well as in mechanisms in the adult body , thus it...
Q: 3. Construct a pedigree chart by following the information given below. A man who is heterozygous fo...
A: The constructed pedigree along with genotypes are attached below. "a" allele carries the trait.
Q: In individuals affected by cystic fibrosis, salt crystals may appear after perspiration dries up. In...
A: Cystic fibrosis is an autosomal recessive disorder.
Q: When a neuron is inactive, more of which of the following exist OUTSIDE the neuron? A. Myelin sheath...
A: Neuron is the fundamental unit of brain and nervous system. Neurons transmit signals from brain to t...
Q: 2. Examine this pedigree chart. mode of inheritance is shown? Explain how you arrived at this decisi...
A: The pedigree chart shown here is a popular tool used in Genetics to explain the mode of inheritance ...
Q: How would you predict an evolutionary shift from horizontal to vertical transmission of a symbiont i...
A: In general, transmission of viruses can occur through two pathways: horizontal and vertical transmis...
Q: f a patient was experiencing difficulty controlling their movement and displaying motor tremors and ...
A: The nervous system can be described as an organ system associated with the flow of information from ...
Q: Suppose there is a new preventative treatment for a common disease. If you take the preventative tre...
A: Disease:A disease is an abnormal condition that negatively affects the structure or function of all ...
Q: Explain the importance of the protein structures (from its primary to quaternary structures) in thei...
A: Introduction:- The amino acid sequence and local, low-energy chemical bonding between atoms in the p...
Q: Which of the following is the ultimate energy source for the organisms (particularly the tubeworms) ...
A: The symbiotic interaction between germs and tube worms benefits both creatures since the bacteria is...
Q: Enter Full Screer 39. How would you describe the quaternary structures below? a. Aquaporin c. Aminop...
A: a. Aquaporin:- The aquaporins (AQPs) are a family of small membrane-spanning proteins having monomer...
Q: Heart beat activity
A: Heart normally beats in a regular rhythm.For an adult,the normal heart beat is 60-100 per minute.Hea...
Q: Explain what makes Thomas Hunt Morgan an interdisciplinary thinker with his Fruit fly discovery
A: Morgan chose the fruit fly, Drosophila melanogaster, for his genetic studies. fruit flies may lack i...
Q: How might culture age affect the results of a spore stain? O If the bacterial culture is too young, ...
A: Bacteria are single-celled, tiny creatures that may enter healthy tissues and grow rapidly. The bact...
Q: What are Thalassemias? Explain how these affect the structure of hemoglobin and how it affects the r...
A: Introduction :- Thalassemia is caused by abnormalities in the DNA of cells that produce haemoglobin,...
Q: Microbes inhabiting the gastrointestinal tract of cattle known as methanogens would most likely be u...
A: The cellular respiration is involved in energy (ATP) production by metabolism of glucose.
Q: Information in DNA is carried to the site of protein synthesis by
A: Central dogma is the process by which gentic information of DNA is transferred from DNA to other mol...
Q: Explain the main regulator being evaluated in the article histone h4 dosage modulates DNA damage res...
A: In hospitals around the world, that is well stated that they are been defined as the Candida glabrat...
Q: An individual whose genotype is AABbCc is crossed with an individual who is heterozygous for all thr...
A: Gamete being an organism's reproductive cell, is a haploid cell which contains only one set of diss...
Q: Please help me answer this reviewer. Determine what the statement is describing. Fill in the blanks...
A: 1. Non-lethal storage of biological material at ultra-low temperature that almost all metabolic acti...
Q: Which bulb shaped structures found at the end of neurons form connections with the dendrites and som...
A: Introduction :- A neuron is a nerve cell that serves as the foundation of the nervous system. In man...
Q: 14. You are studying two strains of C. diptheriae and find that one strain is fully capable of causi...
A: Difference:- The difference between two strains of Corynebacterium diptheria, one of which can caus...
Q: The cell membrane is made up of many diferent kinds of proteins. These proteins can be clasited as e...
A: The cell membrane mainly consists three types of proteins in it. Those are (1) Peripheral protein ;(...
Q: Fig. 1: Vpr counteracts LAPTM5 to promote HIV-1 infection in macrophages.
A: Vpr is the accessory protein of HIV-1 that reinforce the infection in macrophages and LAPTM5 (lysoso...
Q: Does the ATP synthase protein complex have to be located precisely on the membrane in relation to wh...
A: Plants and many other photosynthetic microorganisms use sunlight to generate food and energy. This ...
Q: Multiple Alleles:
A: Given: Gene mutations may produce many different alleles of a gene. Some genes may have as many as 3...
Q: QUESTION 1 Vaccination increases the number of: different receptors that can recognize a pathogen ep...
A: The term vaccination is associated with the action responsible for stimulating the human body’s acti...
Q: How does modification of the insect legs/limbs better equip the insect to survive in a given environ...
A: Insects are adapted their environment in many ways. An adaptation is an adjustment to the environmen...
Q: Please answer fast 1. Fertility can be compromised in women when their body mass index (BMI) falls ...
A: The prenatal development process is divided into three stages. The germinal stage lasts for the firs...
Q: How Sunscreen or Sun Filter ingredient's SPF is measured?
A: As per Bartleby guidelines, we are allowed to answer only one question at a time, please post other ...
Q: The father of three sons and two daughters begins to show symptoms of Huntington disease. What is th...
A: Huntington's disease has an autosomal dominant inheritance pattern which means a single defective g...
Q: What types of gametes are formed by the following genotypes? All gene pairs are segregating independ...
A: Alleles are the alternative forms of genes that are located on the same locus of a homologous chromo...
Q: During absorption, where do fats go into?
A: Fats are lipids and the digestion of lipid begins in the oral cavity itself. In mouth there is a...
Q: How would a mutation in the poly(A)-binding protein gene affect translation? How would an electron m...
A: Restriction digestion analysis of any band that is subjected to the process of reverse transcription...
Q: Describe Brownian motion. What causes it? How does one differentiate between Brownian motion, water ...
A: Brownian motion or movement is that the uncontrolled movement of particles or zigzag pattern of move...
Q: What is the major challenge shared by viruses, prokaryotes and eukaryotes regarding the physical str...
A: A genome refers to the collection of all the genes in a particular organism. Genomes are essentially...
Q: If an organism is 2n=12, How many chromatids are present in prophase of mitosis? 1. 6 How many bival...
A: The indirect process of cell division by which the somatic parent cell divides once to produce two d...
Q: an help me to identify this image by labelled them and describes also
A: This histopathological image is of Nodular Lymphocyte predominant hodgkin lymphoma.
Q: What proportion of the offspring of the following crosses involving independent segregation will be ...
A:
Q: Use the genetic decoder provided to assist in answering this question.\ Second letter A UUU UUC Phe ...
A: Introduction: The process of polymerization of amino acid to form a polypeptide is called translatio...
Q: What are some challenges still today about reproductive cloning
A:
Q: 1. Provided with the following data, compute the corresponding CFU/ml of the original culture. Assum...
A: Various bacterial species are responsible for a variety of diseases in humans. As a result, we apply...
Q: Give a biologic example of the negative feedback loop?
A: Introduction :- A self-regulating system is a negative feedback loop, also known as an inhibitory lo...
Q: Examine your environment or near local ecosystem and look for the species having variation in appear...
A: Variation among the species reduce competition for food even living in a same habitat which eventual...
Q: 191. A 28-year-old lady has asymptomatic dome shaped small lesions on forehead for last 2 months. Sh...
A: Molluscum Contagiosum: A poxvirus causes the infection Molluscum contagiosum (molluscum contagiosum...
Q: Translate this RNA transcript: 5' - UUUCUUAUGUGUCGCCGUAAUUGAUAUUAC - 3'. O Phe-Leu-Met-Cys-Arg-Arg-I...
A: Note: As per Bartleby Guidelines For Remaining Answers Please Repost The Question. Introduction: Tra...
Which of the sequences below do you think would most likely be found in an intrinsically disordered protein?
Intrinsically disordered proteins (IDPs) are those that do not have a proper three-dimensional structure, even under optimal physiological conditions. They have unstructured domains but yet, fulfill their respective functions. They have been shown to perform important functions in cellular signaling.
Trending now
This is a popular solution!
Step by step
Solved in 4 steps
- A common strategy for identifying distantly relatedhomologous proteins is to search the database using a shortsignature sequence indicative of the particular proteinfunction. Why is it better to search with a short sequencethan with a long sequence? Do you not have more chancesfor a “hit” in the database with a long sequence?Based on the alignment of these protein sequences below, which [pairs] of the genes appear to be most similar to each other? [at least mention 2 points]; Why? [at least mention 2 points] Image of the protein sequences :Assume you were given a mixture consisting of one molecule each of all possible sequences of a smallish protein of molecular weight 4800 daltons. If the average molecular weight of an amino acid is, say, 120 daltons, how much would the sample weigh? How big a container would you need to hold it?
- How many binary sequences of length n contain at most five 1 digits? The genetic code specifies an amino acid through a sequence of three nucleotides. Each nucleotide can be of one of the four types T, A, C and G, beingrepetitions allowed. How many amino acids can be encoded in this way?And if there are n types. CompareWhether the statement "Intrinsically disordered regions of proteins can be identified using bioinformatics methods to search genes for encoded amino acid sequences that possess high hydrophobicity and low net charge" is true or false.Suppose you performed two BLAST searches, one on the peptide sequenceFIDPWE and another on the sequence KRTIAAVNSPLLEVATY. Whichsearch do you predict will give you alignments with “expect scores” closerto one? Explain your reasoning.
- What is the expected molecular weight of the protein encoded by the sequence provided here: ATGGCGCACGCTGGGAGAACAGGGTACGATAACCGGGAGATAGTGATGAAGTACATCCATTATAAGCTGTCGCAGAGGGGCTACGAGTGGGATGCGGGAGATGTGGGCGCCGCGCCCCCGGGGGCCGCCCCCGCACCGGGCATCTTCTCCTCCCAGCCCGGGCACACGCCCCATCCAGCCGCATCCCGGGACCCGGTCGCCAGGACCTCGCCGCTGCAGACCCCGGCTGCCCCCGGCGCCGCCGCGGGGCCTGCGCTCAGCCCGGTGCCACCTGTGGTCCACCTGACCCTCCGCCAGGCCGGCGACGACTTCTCCCGCCGCTACCGCCGCGACTTCGCCGAGATGTCCAGCCAGCTGCACCTGACGCCCTTCACCGCGCGGGGACGCTTTGCCACGGTGGTGGAGGAGCTCTTCAGGGACGGGGTGAACTGGGGGAGGATTGTGGCCTTCTTTGAGTTCGGTGGGGTCATGTGTGTGGAGAGCGTCAACCGGGAGATGTCGCCCCTGGTGGACAACATCGCCCTGTGGATGACTGAGTACCTGAACCGGCACCTGCACACCTGGATCCAGGATAACGGAGGCTGGGTAGGTGCACTTGGTGATGTGAGTCTGGGCTGAA particular protein has the amino acid sequenceN . . . Ala-Pro-His-Trp-Arg-Lys-Gly-Val-Thr . . . Cwithin its primary structure. A geneticist studyingmutations affecting this protein discovered that several of the mutants produced shortened protein molecules that terminated within this region. In one ofthem, the His became the terminal amino acid.a. What DNA single-base change(s) would cause theprotein to terminate at the His residue?b. What other potential sites do you see in the DNAsequence encoding this protein where mutation ofa single base pair would cause premature termination of translation?A protein with which of the following sequences may be more prone to undergo farnesylation? (a) Trp-Ala-Ala-Cys (b) Ser-Gly-Gly-Glu (c) Ser-Ala-Ala-Trp (d) Cys-Leu-Leu-Ser
- Shown below is a portion of a DNA sequence ( 31 base pairs long ) that encodes the last amino acids of a protein : The first three underlined base pairs indicate the frame and include the coding region . 123456789 A. Write the peptide sequence of the last 6 amino acids of the protein . Label both ends of the peptide . B. A insertion of one base pair causes the protein to decrease in length by 5 amino acids . With respect to the sequence given above , where does this insertion occur , and what base pair will you insert ? C. An change of one base pair leads to the protein to increase in length by one amino acid. With respect to the sequence given above , which base pair would you change ? How would you change this base pair for the protein to increase in length by one amino acid ?If the sequence of mRNA is 5'-AAUCGUACGGAUGCCGAAAUACCCAUUAGGGAUUGCAUAGCGAGCAACGGAC-3', what is the amino acid sequence it would make? Note: Use one-letter abbreviation for the amino acid sequence Sample answer format: MIGHTYBelow is a sequence of DNA. 5'-ttaccgataattctctctcccctcttccatgattctgattaaagaaggcgagaacgaaactatttgttaatacc-3' Using the one letter code for Amino Acids, what is the predicted AA sequence of the shortest ORF (from N to C-terminal end)? Using the one letter code for Amino Acids, what is the predicted AA sequence of the longest ORF (from N to C-terminal end)?