What are the key properties of the genetic code? Given that the genomes of all organisms are made up of As, Ts, Cs, and Gs, how does one account for diversity in organisms? What are some factors that could adversely affect diversity in nature?

Q: Explain why the genetic code is said to be redundant and virtually universal? How these features may…

A: Amino acids are building blocks of proteins. They are a set of rules that governs how codons are…

Q: What is meant by “Universality and Degeneracy” of the Genetic Code? What is the significance of the…

A: DNA have four bases, A, T, G and C, and proteins are made up of 20 different amino acids. Thereby…

Q: While studying the structure of a small gene that was recently sequenced during the Human Genome…

A: The rule in the case of DNA indicating that there is always equality in quantity between the bases A…

Q: If you know the sequence of amino acids in a protein, what does the genetic code table allow you to…

A: Amino acids are the building blocks of proteins. Proteins serve as structural support inside the…

Q: If a single strand of a gene contains 678 bases, how many amino acids result in the polypeptide…

A: The biochemical substance that is carried from the preceding generation to the succeeding generation…

Q: What does it mean when we say that the genetic code contains degeneracy? Discuss the universality of…

A: After the process of Transcription, when a small segment of DNA is transcribed into a strand of…

Q: Do most cells contain complete copies of an organism’s DNA? Do most cells express all of the genes…

A: Genome is composed of all the genes present in an organism present in the nucleus. A genome can be…

Q: What is the completing sequence of nitrogen- containing bases for a AGCCGTTAAC fragment of a DNA…

A: DNA base pairs are due to the formation of hydrogen bonds between the nitrogenase bases, purines,…

Q: When proteins recognize and bind to a specific sequence in DNA, why do they usually just recognize…

A: DNA binding proteins are proteins that bind to single or double stranded DNA generally in the major…

Q: How might a single base pair difference about 100 bases before the start codon of a gene cause a…

A: The first codon of the mRNA (messenger ribonucleic acid) translated by the ribosome is called the…

Q: What are the known exceptions to the genetic code?

A: Genetic code:  Genetic code is the term wherein each three nucleotides (out of four) in a row is…

Q: What is the consensus sequence of the following six DNA…

A: DNA or the Deoxyribonucleic acid present in both eukaryotes and prokaryotes are made up of millions…

Q: Why are there nucleotides (A, T, G, and C) in the master mix? What are the other components of the…

A: PCR is a technique that results in exponential amplification of a selected region of a DNA molecule…

Q: What is meant by the term DNA sequence?

A: Nucleic acids are the large biomolecules, essential to all known forms of life. They are composed of…

Q: What are some of the important genetic implications of the DNA structure?

A: Deoxyribonucleic acid (DNA) is the genetic material of most organisms that carry coded genetic…

Q: Why are most DNA-binding proteins specific to certain chemicalgroups within the DNA?

A: DNA is the genetic material that carries genetic information in the form of coded nucleotide…

Q: How many bits of information are stored in an 8-mer DNA sequence? In the E. coli genome? In the…

A: In DNA the digital data has been stored including the encoding and decoding of the DNA sequence. The…

Q: If a bacterial protein is 3,300 amino acids long, how many nucleotidepairs long is the gene sequence…

A: Introduction  Genome consists of DNA/RNA which consists of nucleotides either deoxyribose…

Q: How many bases make up a codon?

A: The flow of genetic information from DNA to mRNA to proteins is central dogma where the process of…

Q: What might be the result of a mutation of DNA in which a triplet code such as UAC now says UAA in…

A: Genetic material is nothing but the sequence of nucleic acids which is called as DNA. It contains…

Q: Why do you expect to encounter a stop codon about every 20 codons or so in a random sequence of DNA?

A: During the translation process, the termination step occurs when the Stop codon in mRNA comes and…

Q: how is The Genetic Code Is Almost,but Not Quite, Universal?

A: The genetic code is the set of rules used to translate information encoded within the messenger…

Q: The A+T: G+C ratios in DNA of cattle and rat are very similar. Would you expect the tRNA, rRnas, and…

A: Chargaff's rules state that DNA from any species of any organism should have a 1:1 protein…

Q: What does it mean when we say that the genetic code is degenerate? Discuss the universality of the…

A: The genetic code is a system of triple letter codons that are made up of a combination of the…

Q: Does a single base-pair substitution in a strand of DNA always result in a new amino acid in the…

A: Transcription is processed to convert DNA into RNA. It is part of the central dogma. It is processed…

Q: What are the exceptions to the general rule that DNA is the genetic material in all organisms? What…

A: The exception is that RNA is the genetic material in some organisms. Many viruses have been shown to…

Q: When is a DNA sequence said to be conserved?

A: DNA (Deoxyribonucleic acid) and RNA (Ribonucleic acid) are the two important classes of nucleic…

Q: What is the numeric relation between pyrimidine and purine bases in the DNA molecule? Is that…

A: DNA and RNA are nucleic acids present in the organisms. DNA is the deoxy ribose nucleic acid whereas…

Q: What is the significance of the fact that many synonymous codons differ only in the third nucleotide…

A: Codons are the three consecutive nucleotides on mRNA which specify amino acids or stop signal for…

Q: Why did DNA, rather than RNA, evolve to be the carrier of genetic information in cells?

A: This is one of the primary dissimilarities between DNA and RNA. DNA (Deoxyribonucleic acid) is the…

Q: Explain what is meant by stating that the genetic code is triplet and nonoverlapping? What did the…

A: The genetic code may be defined as the exact sequence of DNA nucleotides read as three letter words…

Q: hat will be the order of amino acids derived from the following DNA sequence 5’-TGATCGCACAAT-3’?…

A: introduction

Q: Why did geneticists believe, even before direct experimental evidence was obtained, that the genetic…

A: The amino acid sequence of proteins is determined by the sequence of nucleotides in deoxyribonucleic…

Q: Why is rRNA so suitable for determining relatedness?

A: Cells form life's basic unit. A cell has different macromolecules, including carbohydrates,…

Q: what is Conservation of the genetic code?

A: DNA is the genetic material that carries genetic information in the form of coded nucleotide…

Q: What is the Evidence that each nucleotide is part of only one codon?

A: DNA is the genetic material that carries genetic information in the form of coded nucleotide…

Q: Why is the identification of genes for noncoding RNAs more difficult than the identification of…

A: Coding RNAs are responsible for coding proteins, while non-coding RNAs do not code for proteins.…

Q: If proteins were composed of only 12 different kinds of aminoacids, what would be the smallest…

A: A codon is a sequence of 3 DNA/RNA nucleotides that corresponds to a specific amino acid during…

Q: How are cis-encoded RNAs, micro RNAs, and small interfering RNAs alike? How do they differ? What…

A: RNA is the nucleic acid present in the cells of living beings.

Q: What are the three main types of RNA? What is meant by heterogeneous RNA?

A: RNA stands for ribonucleic acid and it is a type of nucleic acid. Some of its important function…

Q: Why is DNA & not RNA is the genetic material in majority of organisms?

A: Genetic material is composed nucleic acids. DNA stands for deoxyribonucleic acid and RNA stands for…

Q: A hypothetical base sequence of an RNA molecule is5′–AUUUGCCCUAGCAAACGUAGCAAACG–3′What topic in…

A: Answer: Introduction: RNA molecule consists of four nucleotide bases these are adenine (A), cytosine…

Q: What is the concept of universality of the genetic code? What are the exceptions to this…

A: As we know that there are four nucleotide bases i.e. the A, T, G, C which are arranged in the form…

Genome annotation

The technique of linking biological information to genome sequences is termed genome annotation. Gene annotation is the method of identifying gene locations and coding sections. It helps us understand what these genes are doing in the body through establishing structural characteristics and linking them to the actions of various proteins.