III. Discuss the following aspects of translation: 1. How does the location and timing of transcription/translation differ between prokaryotes and eukaryotes? 2. How do the types of ribosomes differ between prokaryotes and eukaryotes? 3. How does the first amino acid of the translated protein differ between bacteria, archaea, and eukaryotes?

Q: 18. In the following figure, structure C represents a , while structure F represents a Asparagine D…

A: The figure shows the process of translation.Translation is the process in which ribosomes in the…

Q: Describe the different stages that process of Protein synthesis.

A: Protein synthesis is the cycle where cells make proteins. It happens in two phases: transcription…

Q: 2. Complete the leading strand and the complementary strand vith the 5'and 3' ends and identify he…

A: DNA replication is the process by which a new DNA molecule is formed and this process is known as…

Q: 2. What happens during translation? is read and Possible sentence frame: Translation is the process…

A: The protein synthesis occurs in cytoplasm by the process of translation.

Q: 1. Assume that the ribosome has just catalyzed the formation of a peptide bond, but the ribosome has…

A: Translation of the nucleotide bases sequence in the mRNA to the amino acids results in the formation…

Q: 8. Explain the role of post-translational modifications of protein molecules: the formation of…

A: By covalently adding functional groups or proteins, proteolytic cleavage of regulatory subunits, or…

Q: 6 What is the complement of the mRNA triplet code in the tRNA? 7 In what way is tRNA different from…

A: RNA molecules are also called ribonucleic acids. RNA is composed of nucleotides attached with each…

Q: What is the central dogma? What are the compounds involved in this process? (Keywords: transcription…

A: A "nucleic acid" is a linear polymer of nucleotides that is a component of the cell's information…

Q: 1. Label the diagram below with the following terms: O DNA Ribosome MRNA Transcription tRNA…

A: Transcription and translation are the components of gene expression. These two processes are known…

Q: which does not play a role in translation?

A: The translation is the process in which the message coded by an mRNA is translated into a sequence…

Q: 2. Identify the following structures when given images such as the ones below: ● process of…

A: Introduction The cell is the basic structural and functional unit of life present in all living…

Q: 6. When can a mutation on the DNA cause production of a longer translation product? Give a specific…

A: * Types of gene variations  Missence Nonsense Frameshift mutation Insertions Deletions Inversions…

Q: 1. A certain mRNA codon is determined to be AUG. a. What is the tRNA anticodon? b. What is the DNA…

A: Transcription is the transfer of genetic information from sequence of DNA to RNA, Transcription…

Q: During protein synthesis, which of the following are involved in the steps that take place in the…

A: Protein synthesis takes place via a process called translation . Before translation  mRna have to be…

Q: 3. Label the illustration below using the following terms: DNA, MRNA, codon, transcrip translation,…

A: All the living organisms contain genetic material. The genetic material is responsible for passing…

Q: 20. Initiation and elongation in translation requires         A ATP         B.TTP…

A: The translation is the process of protein synthesis in the cell. It takes place in the cytoplasm of…

Q: 3. On the diagram below, draw how the mRNA is translated into a peptide beginning with the third…

A: This question we have to describe about process of translation.

Q: 2. There is no sigma factor on the RNA polymerase II. How does RNA polymerase Il know where to start…

A: Usually in Eukaryotic transcription initiation the transcription factor identifies promoter and then…

Q: 2. Describe the process that is occurring in this image protein nibosome

A: The proteins are the final product of a gene that perform all the functions within the cell.…

Q: Briefly describe the function of the following in protein synthesis: a) rRNA, b) tRNA c) mRNA

A: Ribonucleic acid (RNA) is a genetic material that is prepared from the deoxyribonucleic acid (DNA)…

Q: 1. Using the central dogma of molecular biology, explain the terms replication, transcription and…

A: Since you have asked multiple questions, we will answer only the first question for you. If you want…

Q: 6) The diagram shows a strand of DNA matched to a strand of messenger RNA. MRNA is being made from…

A: Francis crick proposed central dogma which gives the flow of genetic information from DNA to RNA to…

Q: Select ALL of the following that apply to translation. Select one or more: a. occurs in the nucleus…

A: The translation is a process that is part of the central dogma that follows the process of…

Q: A tRNA to which the correct amino acid has been attached is called

A: tRNAs bind to codons within the ribosome and deliver amino acids for the protein chain to be…

Q: 1. What is meant by the term ‘redundancy’ in the context of the genetic code? b) What are the…

A: Answer: DNA sequence is the sequence of nucleic bases arranged in an order which can able to read…

Q: 5. What mutation(s) would eliminate peptide translation? Nonsense mutation

A: In the given case, the sequence of DNA is given. The RNA contains uracil in place of thymine. Thus…

Q: Which of the following is a true statement concerning condons

A: Codons are nucleotide triplets that are read together in order to specify amino acids during…

Q: What are the components of the initiation complex for translation

A: Translation is a process in which codon of mRNA code for specific amino acid. These amino acid…

Q: SOURCE: GENERAL, ORGANIC AND BIOLOGICAL CHEMISTY by Smith 4th Edition

A: mRNA or messenger RNA is a polymer of ribonucleotides that has a sequence corresponding to the…

Q: 3. The principle theme in biology is DNA transcribes to RNA and RNA translates to proteins. Place…

A: Introduction: The process of copying the genetic information from one strand of the DNA into RNA is…

Q: How many codons are there in the mRNA?

A: Here, the given original DNA sequence is: 5'ATGCCTGGACGCAATGCGAGCTGGCTTAACTCAGGGCGTTGA3' So,the mRNA…

Q: 1. Why is specific.base pairing essential to the process of transcription and translation? How many…

A: INTRODUCTION There are total 64 codons that code for a total of 20 amino acids. Out of the 64…

Q: 2. (a) Consider Amino Acid Sequence 2. How is Amino Acid Sequence 2 different from Amino Acid…

A: The explanation is given below.

Q: C A T A C G C G T A с G

A: The given figure shows the process of DNA replication. DNA replication refers to the process of…

Q: 7. A mad scientist has all the molecules necessary for protein synthesis in a test tube. Included in…

A: The genetic material that makes up DNA is referred to as the "building block of life." Many…

Q: Discuss the difference between intron and Exon

A: Exons are named as nucleic acid coding successions & they are available in mRNA. Introns are…

Q: Illustrate the process of transcription by providing the correct bases for mRNA strand given the DNA…

A: Transcription is the process where the genetic information on the DNA strand is transferred into an…

Q: (6C) The diagram below shows the process of translation. protein moleçule forming Bead and re-read…

A: which of the following describe the role of the ribosome :

Q: 39. Match the following functions to the letters in the picture 67'F The doyua of cell biology (The…

A: Answer

Q: .  Considering the following nucleotide sequence in an mRNA molecule: 5’ AUG UUA CGU AAU GCU GUC…

A: The central dogma of life involves three processes. They are: Replication: - In this process,…

Q: 5. For each statement, choose the letter that applies the best: P for prokaryote, E for eukaryote, B…

A: Prokaryotes are characterized by the absence of nucleus and membrane bound organelles of eukaryotes…

Q: 4. Draw and label the Transcription process. 5. Draw and label the Translation process.

A: Transcription is the process in which RNA is made from DNA, while  translation is the process in…

Q: 5. Which of the following is NOT true about polypeptides? The peptide bond that links the amino…

A: Polypeptide is an unbranched chain of amino acids. Amino acids are linked together by peptide bonds.…

Q: 3. Where does transcription specifically take place in the cell? 4. Where does translation…

A: 3. The process of transfer of genetic information from DNA to mRNA (messanger RNA) is called…

Q: 4. Mark the following statements about the genetic code as TRUE or FALSE: The genetic code is…

A: Genetic code is a set of three nucleotides where one triplet is called as one codon.

Q: 4. A mutation changes a nonsense codon to an amino acid sequence. Write an example of such a…

A: Mutation is any change in the sequence of DNA that causes a change in the protein that is…

Q: 1.  The enzyme activity that forms peptide bonds on the ribosome is called peptidyl transferase.…

A: Answer:-  The process in which the peptide bonds formation occur in between the ribosome called…

Gene Interactions

When the expression of a single trait is influenced by two or more different non-allelic genes, it is termed as genetic interaction. According to Mendel's law of inheritance, each gene functions in its own way and does not depend on the function of another gene, i.e., a single gene controls each of seven characteristics considered, but the complex contribution of many different genes determine many traits of an organism.

Gene Expression

Gene expression is a process by which the instructions present in deoxyribonucleic acid (DNA) are converted into useful molecules such as proteins, and functional messenger ribonucleic (mRNA) molecules in the case of non-protein-coding genes.