Procedure:Refer to the Genetic Code Table below to identify the right amino acid coded.To determine the order of bases in the first column (uNA), second column (codon) and the third columnis the anticodon. Consider the complementary base pair in DNA and in RNATo identify the amino acid, took at the bases in the MRNA codon, example AUG using the Genetic CodeTable. Lool: for the first letter of the MRNA codon on the left side of the genstic code table (A), thesecond letter of the MRNA on the second letter column (U), and the third letter on the right-side column(G). AUG codes for the amino acid -methionine, Do the same with the other codons in the chart.Genetic Code Table2nd posttion of codonUUU PhePhenylalanine UCU Ser S SerinePhenylalanine UC C Ser S SerineUCA Ser S SerineUCe Ser S SerineCCU Pra P ProlineUAU Tyr Y TyrosineUAC Tyr Y TyrosineUGU Cys C ysteineUGC Cys C CysteineUUC Phe FUUA LauUUG LeuCUU LeuCUCCUALeucineUGAUGG Trp W Tryptophan GstopstopLLeucineLeucineLAGCAU His H HistidineCAC Hs H HistidineCAA Gin Q GlutaineCAG Gin Q Glutaminestopcau Arg R Argininecac Arg R ArginineCGA Arg R ArginineArgin neLeuLeucineCCCPro P ProlineCCA Pro P ProlinecCG Pro ProlineACU Thr T Threonine AAU Asn N AsparagineAGU Ser sACC Thr T Threor in AC Asn II Asperagine AGC SerSACA Thr T Threonine AAA Lys K LyaineACG Thr T Threonine AAG Lys K LysineGcu Ala A AlanineGGG AlaA AlanineGCA Ala A AlanineGCG Ala A AlanineLeuLeucineCUG LeuAUU IleLeucineIsoleucineCGG ArgRSerineAUC ileIsoletucineAUA leAUG Met M MethionineGUU ValGUC ValGUA ValGUG ValSerineAGA Arg R ArginineAGG Arg K ArginineGGU Gly G alycineGGC Gly G GlycineGAA Glu E Glutamate GGA Gly G GlycineGAG Glu E Glutamate GaG Gly G GlycineIsoleucineGAU Asp D AspartateGAC Asp D AspartateValineVarinev Valinev Veline1. Why is specific.base pairing essential to the process of transcription and translation?2.How many codons codes for one amino acid?Ist postion of codon)ard postion of coden (3) Order of bases in DNAOrder of bases in MRNA(codor)AUCOrder of bases in tRNAAmino acid coded into(anticodon)UAGTAGproteinsCATCAUGUCCCAATGMethionine (Met)Vallne (Val)GUU, GUC, GUA, GUGACUACAUGUAAAAAAGAACUUProcedure:

Name: Procedure:Refer to the Genetic Code Table below to identify the right
Uploaded: 2024-03-20T06:42:41.000Z
Channel: Bartleby
Description: Procedure:Refer to the Genetic Code Table below to identify the right amino acid coded.To determine the order of bases in the first column (uNA), second column (codon) and the third columnis the anticodon. Consider the complementary base pair in DNA

INTRODUCTION There are total 64 codons that code for a total of 20 amino acids. Out of the 64…

Answered: 1. Why is specific.base pairing…

Science

Biology

1. Why is specific.base pairing essential to the process of transcription and translation? How many codons codes for one amino acid? 2.

Biology Today and Tomorrow without Physiology (MindTap Course List)

5th Edition

ISBN:9781305117396

Author:Cecie Starr, Christine Evers, Lisa Starr

Publisher:Cecie Starr, Christine Evers, Lisa Starr

Chapter7: Gene Expression And Control

Section: Chapter Questions

Problem 1VQ

See similar textbooks

Similar questions

Complete the phrases with the correct word or words. The task is to match the lettered items with the correct numbered items. Appearing below is a list of lettered items. Following that is a list of numbered items. Each numbered item is followed by a drop-down. Select the letter in the drop down that best matches the numbered item with the lettered alternatives. a. methionine b. ribosome c. codon d. AUG e. UAC The mRNA moves out of the nucleus and attaches to a The first codon of an mRNA molecule is always As soon as the first codon is in place, a tRNA molecule arrives with the anti-codon The first tRNA to arrive always carries the amino acid called, The ribosome scoots along the mRNA to read the next
Transcribe the following DNA strand into mRNA and translate that strand into a polypeptide chain, identifying the codons, anticodons, and amino acid sequence. DNA: C G A T A C A A T G G A C C C G G T A T G C G A T A T C C mRNA: Codon: Anitcodon: Amino Acids:
Translate the following RNA sequence by using the genetic below. Start at the beginning of the sequence and don't worry about start and stop codons. Write out the sequence using the single letter code. (This table displays the amino acids in a single-letter code instead of a three-letter code. Each codon is found by matching the first position on the left of the chart, second position at the top, and last position at the right. For example, the codon CAG gives the amino acid "Q") 5' UCAACUGCGAAUCUGGAAUAU 3'
State if the DNA is written 5' to 3' or 3' to 5' Transcribe the sequence. Include the 5' and 3' Translate the sequence (codon chart included) +1 TAGTCCAAAGGTTTACGTAAATGGGATGTCGAAATTGACTAGATCA
Explain the process translation. A complete answer will include the words below tRNA, amino acid, polypeptide chain, ribosome, mRNA, codon, anticodon, nucleotides, base pairing rules, sequence
Using the codon table, identify a 5’-3’ sequence of nucleotides in the dna template strand for mRna coding for the polypeptide sequence NH2-PHe-Pro-lys-COOH.
Gene Expression: Illustrate some steps involved in RNA processing and identify the sequence of amino acids in a polypeptide chain corresponding to the codons in the mRNA. Procedure and Questions: The following segment of DNA codes for a protein. The uppercase letters represent exons. The lowercase letters represent introns. The lower strand is the template strand. 1. Indicate the 3’ and 5’ ends of both strands. G C T A T A A T G G C A a a a t t g G G T C A G G C A a a t c g a C A T A G C T G A C G G g g a t g a G G T T A A C G A T A T T A C C G T t t t a a c C C A G T C C G T t t a g c t G T A T C G A C T G C C c c t a c t C C A A T T 2. Write the pre-mRNA molecule. Indicate the 3’ and 5’ ends. 3. Write the mRNA molecule. Indicate the 3’ and 5’ ends. 4. Write the tRNA anticodons corresponding to the codons in the mRNA. 5. Write the sequence of amino acids in the resulting polypeptide
What is the complementary DNA sequence to the following DNA sequence? ATGCCATCG ____________________________ Write the mRNA codon sequence for the following DNA sequence. CTGCACTGA ____________________________ Write the anticodon tRNA sequence for the following mRNA sequence. UACGACUAG ____________________________ Name the amino acids that use the following mRNA codons. CAU ______________________________ AUG ______________________________ AAG ______________________________ CCC ______________________________ Name the amino acids that use the following DNA codons TAT ______________________________ CGA ______________________________ List the amino acid sequence for the following mRNA code. Be sure that you start with the first start codon you get to and then proceed to list the amino acids until you get to a stop codon. CGUAUGACUGGAAUACUUUAGCCAGCU __________________________________________________________________
transcribe the following DNA strand into mRNA and translate that strand into a polypeptide chain, identifying the codons, anticodons, and amino acid sequence. DNA: T A C G G G C C T A T A C G C T A C T A C T CA T G G A T C G G mRNA: Codon: Anitcodon: Amino Acids:
Write down the corresponding amino acids sequence for each mRNA sequence. Use the codon chart.
Transcribe the following DNA strand into mRNA and translate that strand into a polypeptide chain, identifying the codons, anticodons, and amino acid sequence. DNA: C G A T A C A A T G G A C C C G G T A T G C G A T A T C C mRNA: G C U A U G U U A C C U G G G C C A U A C G C U A U A G G Codon: Anitcodon: Amino Acids:
Translate to amino acids the strand using the Genetic Code chart. Remember to use the start and stop sequences. UGCGAUGGCAAUCGGUGUACCCCUGACUGAGC